ID: 1043306249

View in Genome Browser
Species Human (GRCh38)
Location 8:78800305-78800327
Sequence AAACCCTGTCTCAAAAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1773
Summary {0: 1, 1: 10, 2: 83, 3: 464, 4: 1215}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043306249_1043306251 -3 Left 1043306249 8:78800305-78800327 CCTCTCTTTTTGAGACAGGGTTT 0: 1
1: 10
2: 83
3: 464
4: 1215
Right 1043306251 8:78800325-78800347 TTTCACTCTGCTGCCCAGGCTGG 0: 58
1: 2252
2: 31472
3: 116698
4: 316145
1043306249_1043306250 -7 Left 1043306249 8:78800305-78800327 CCTCTCTTTTTGAGACAGGGTTT 0: 1
1: 10
2: 83
3: 464
4: 1215
Right 1043306250 8:78800321-78800343 AGGGTTTCACTCTGCTGCCCAGG 0: 12
1: 504
2: 7524
3: 40565
4: 150551
1043306249_1043306252 7 Left 1043306249 8:78800305-78800327 CCTCTCTTTTTGAGACAGGGTTT 0: 1
1: 10
2: 83
3: 464
4: 1215
Right 1043306252 8:78800335-78800357 CTGCCCAGGCTGGAGTGCAGTGG 0: 2283
1: 73292
2: 180736
3: 244256
4: 185273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043306249 Original CRISPR AAACCCTGTCTCAAAAAGAG AGG (reversed) Intronic
900143467 1:1148038-1148060 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
900162511 1:1231081-1231103 AGACCCTGTCTCGAAAAAGGGGG + Intronic
900669854 1:3844687-3844709 AAATTCTGTCTCAAAAAAAAAGG + Intronic
901105163 1:6749751-6749773 AGACCCTATCTCAAAAGAAGAGG - Intergenic
901172562 1:7270803-7270825 AGACCCTGTCTCAAAAACAATGG + Intronic
901430768 1:9213253-9213275 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
901471778 1:9461645-9461667 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
901554766 1:10023091-10023113 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
901601801 1:10428519-10428541 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
901704888 1:11066189-11066211 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
901843880 1:11970421-11970443 ATACCCTGTCTCAAAAAATAAGG + Intronic
901897238 1:12324492-12324514 AGACTCTGTCTCAAAAAAAAAGG + Intronic
902306759 1:15546302-15546324 AGACCCTGTCTCAGAAAAAAGGG + Intronic
902396962 1:16137586-16137608 AGACTCTGTCTCAAAAAAAAGGG + Intronic
902403306 1:16169761-16169783 ACACTCTGTCTCAAAAAAAAAGG - Intergenic
902517610 1:16997829-16997851 AAACTCTGTCTCAAAAGAGGAGG + Intronic
902524060 1:17042764-17042786 AGACCCTGACTCAAAAAAAAAGG + Intronic
902874927 1:19335273-19335295 AGACCCTGTCTCAAAAGAAAAGG + Intergenic
903025215 1:20424538-20424560 AGACCCTGTCTCAAAAAAAGAGG + Intergenic
903120452 1:21213493-21213515 AAACCCTGTCAAAAAAAAAAGGG - Intergenic
903208067 1:21797909-21797931 AGACCCTGTCTCAAAAGAAAAGG - Intergenic
903378558 1:22881601-22881623 AAACTCTGTCGCAAAGAGTGGGG - Intronic
903407307 1:23108589-23108611 AAACCCAGTCTCAGAAAAAAAGG + Intronic
903635158 1:24808523-24808545 AGACCCTGTCTCAAAAAAAAGGG - Intronic
903872376 1:26445700-26445722 AGACCCTGTCTCCAAAAAAGGGG + Intronic
903884457 1:26532737-26532759 CAACTCTGTCTTAGAAAGAGGGG - Intronic
903890011 1:26563234-26563256 AGACCCTGTCTCAAAAAAAAGGG - Intronic
904049221 1:27628336-27628358 AAACTCTGTCTCAAAAAAGAAGG + Intronic
904065957 1:27751136-27751158 AGACTCTGTCTCAAAAAAAAAGG + Intronic
904086424 1:27912534-27912556 AGACCCTGTCTCAAAAAAAAAGG + Intronic
904138609 1:28333847-28333869 AGACTCCGTCTCAAAAAAAGCGG + Intronic
904155251 1:28477700-28477722 AGACACTGTCTCAAAAAAAAAGG - Intronic
904156341 1:28486344-28486366 AAACTCTGTCTCAAAAAGAAAGG + Intronic
904185263 1:28698969-28698991 AGACTCTGTCTCAAAAAAAAAGG + Intronic
904576778 1:31509947-31509969 AGACTCTGTCTCAAAAAGAGAGG - Intergenic
904626418 1:31807377-31807399 AGACTCTGTCTCAAAAGGGGAGG + Intronic
904632630 1:31854241-31854263 AGACCCTGTCTCAAAAAAATAGG + Intergenic
904658790 1:32069351-32069373 AGACCTTGTCTCAAAAAAAGCGG - Intergenic
904665255 1:32115753-32115775 AGACTCCGTCTCAAAAAGAAAGG - Intronic
904690212 1:32288168-32288190 AAACCCCATCTCAAAAAAAAGGG + Intergenic
904703517 1:32373528-32373550 AGACCCTGTCTCAAAAAAATAGG - Intronic
904719386 1:32495870-32495892 AGACCCTGTCTCAAAAAAAAAGG + Exonic
904918889 1:33991026-33991048 AGGCCCTGTCTCTAAAAAAGAGG - Intronic
904934137 1:34114686-34114708 AGACCCTGTCTCAAAAAAAAAGG + Intronic
905265055 1:36746664-36746686 AGACCCTGTTTCAAAAAAAAAGG + Intergenic
905419024 1:37826294-37826316 AGACCCCGTCTGAAAAAAAGGGG - Intronic
905434365 1:37946682-37946704 AAAAACTGTCCCCAAAAGAGAGG - Intronic
905469518 1:38181348-38181370 AAACTCTGTCTCAAAAAAAGCGG - Intergenic
905476950 1:38235688-38235710 AGACCCTGTCTCAAAAAAGGGGG + Intergenic
905613527 1:39376723-39376745 AGACCCTGTCTCTAAAAGGAAGG - Intronic
905705691 1:40055516-40055538 AGATCCTGTCTCAAAAAAAAAGG - Intronic
905831381 1:41071670-41071692 AGACTCTGTCTCAAAAAAAAAGG - Intronic
905930472 1:41783360-41783382 ACACACTGACTCAAAGAGAGGGG + Intronic
905946896 1:41909185-41909207 AAAACCTCTCTCAAAAACAAGGG + Intronic
906134258 1:43484982-43485004 AGACCTTGTCTCAAAAAAAAAGG - Intergenic
906218925 1:44061905-44061927 AAACTCTGTCTCAAAAAAAAGGG + Intergenic
906406777 1:45548563-45548585 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
906469040 1:46111713-46111735 AGACTCTGTCTCAAAAAAAAGGG + Intronic
906841134 1:49140464-49140486 ATACACTGTCTTAAAAAGATTGG - Intronic
907028350 1:51144701-51144723 AGACCCTGTCTCAGAAAAAAAGG + Intronic
907035005 1:51208351-51208373 AGACCCTGTGTCAAAAAAAAAGG + Intergenic
907191607 1:52653746-52653768 AGGCCCTGTCTCAAAAAAAAAGG - Intronic
907816182 1:57920320-57920342 AGGCCCTGTTTCAAAAAAAGGGG - Intronic
907971673 1:59388955-59388977 AGACCCTGTCTAAAAAAAAGAGG - Intronic
908283650 1:62569721-62569743 AGACTCTGTCTCAAAAAAAAAGG - Intronic
908378893 1:63575593-63575615 AGACTCTGTCTCAAAAAAAATGG - Intronic
908731183 1:67228201-67228223 AGACCCTGTCTAAAAAAGAAGGG - Intronic
909077137 1:71062720-71062742 AAACCTTATGTCAAAAACAGGGG + Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909141795 1:71876494-71876516 AGACCCTGTCTGAAAAAGAAAGG + Intronic
909433965 1:75619059-75619081 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
909926338 1:81441847-81441869 AGACCCTGTCTCAAAAAAAATGG - Intronic
910546928 1:88428929-88428951 ATATCCTGTCTCAAAAAAAGTGG + Intergenic
910655636 1:89615399-89615421 AGACCCTGTCTAAAAAAAGGGGG + Intergenic
910700524 1:90069428-90069450 AGACCCTGTCTCAGAAAAAAAGG - Intergenic
910784731 1:90983916-90983938 AGACTCTGTCTCCAAAAAAGAGG + Intronic
911143850 1:94533874-94533896 AGACTCTGTCTAAAAAAGAAAGG - Intronic
911368471 1:96969072-96969094 TAACACTGTCTGCAAAAGAGTGG - Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
911953877 1:104211256-104211278 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
912227264 1:107748371-107748393 CAACCCTGTTTCAAAAGGAATGG - Intronic
912773608 1:112488863-112488885 AAATCCTGTCTCTAAAAAAACGG - Intronic
912796226 1:112695208-112695230 AGACTCTGTCTCAAAAAAAAGGG + Intronic
912916740 1:113822947-113822969 AGACTCCGTCTCAAAAAAAGCGG + Intronic
914215883 1:145627785-145627807 TATCCCTGTCTCAGAAAGGGTGG - Intronic
914262593 1:146011503-146011525 AGATCCTGTCTCAAAAACAAGGG - Intergenic
914467827 1:147948170-147948192 TATCCCTGTCTCAGAAAGGGTGG - Intronic
914737608 1:150432966-150432988 AGACCCTGTCTCAAGGTGAGGGG + Intronic
914775620 1:150731914-150731936 AGACCCTGTCTTAAAAAAAGAGG - Exonic
914812763 1:151041173-151041195 AGACCCTGTCTCAAAAAAAAAGG + Intronic
914849131 1:151301223-151301245 AGACTCTGTCTCAAAAAAAAAGG - Intronic
914856282 1:151353288-151353310 AGACCCTGTCTCAAAAAAATAGG + Intergenic
914856769 1:151358040-151358062 AAACTCCGTCTCAAAAAAAAAGG - Intergenic
914858056 1:151366377-151366399 AGACCCTGTCTCTAAAAGATGGG - Exonic
914863894 1:151409382-151409404 AGACCCTGTCTCAAAAAAAGGGG - Intronic
914907753 1:151760728-151760750 AAACCCTGTCTTTAAGAGAAAGG + Intronic
915240382 1:154516935-154516957 AGACCCTGACTCAAAAAAAAAGG + Intronic
915351108 1:155226871-155226893 AGATCCTGTCTCAAAAAAAGGGG - Intergenic
915372649 1:155364251-155364273 AGACCTTGTCTCCAAAAGAAGGG + Intronic
915455499 1:156037920-156037942 AGACCCTGTCTCAAAAAAAAAGG - Intronic
916149018 1:161767862-161767884 AAACTCCATCTCAAAAAAAGAGG - Intronic
916257179 1:162800987-162801009 AGACTCTGTCTCAAAAAAAAAGG - Intronic
916550313 1:165843728-165843750 AGACCCTGTCTCTAAAAAACAGG + Intronic
916639900 1:166716598-166716620 AGACCCTGCCTCAAAAAGAAAGG + Intergenic
916661363 1:166925004-166925026 AGACCTTGTCTCAAAAAAAAAGG + Intronic
916667330 1:166977939-166977961 AGACCCTGTCTCAAAAAAAATGG + Intronic
916962856 1:169906708-169906730 AAGCCCAGTTTCAAAAAGTGAGG + Intergenic
916999668 1:170342843-170342865 ACACCCTGTGTCAAAGAAAGGGG - Intergenic
917327389 1:173846784-173846806 AGACCCTGTCTCAAAAAAAAAGG + Intronic
917435835 1:175020515-175020537 AAACTCCGTCTCAAAAAAAGGGG - Intronic
917467079 1:175289247-175289269 AAAGCCTGTACCAAAAAGAAGGG - Intergenic
917554853 1:176073946-176073968 AGACTCTGTCTCAAACAAAGAGG - Intronic
917926974 1:179797441-179797463 AAACTCTGTCTCAAAAAAAAGGG + Intronic
918081270 1:181209504-181209526 AGACCCTGTCTCAAAAAGAAAGG - Intergenic
918382670 1:183972117-183972139 AGACCCTGTCTCAAAAAAAGAGG - Intronic
918480409 1:184971657-184971679 AGACTCTGTCTCAAAAAAAAAGG + Intronic
918503722 1:185228079-185228101 AGACCCTATCTCAAAAAGAAAGG + Intronic
918705589 1:187657713-187657735 AAAATCTGTGTCAAAAATAGTGG + Intergenic
918974978 1:191472174-191472196 AGACCCAGTCTCAAAAAAAAAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
919295145 1:195688551-195688573 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
919458305 1:197846211-197846233 AAACCATGTCTCAAAAAGAAAGG - Intergenic
919851507 1:201676131-201676153 ACACCCTATCTCAGAAAGAGGGG - Intronic
919988370 1:202691638-202691660 AGACCCTGTCTCAAAAAGGGAGG + Intronic
920114645 1:203611584-203611606 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
920242974 1:204567100-204567122 AGACCGTGTCTCAAAAAAAAAGG + Intergenic
920412499 1:205773524-205773546 AGACCCTGTCTCAAAAACAAAGG - Intronic
920934152 1:210415666-210415688 AGACTCTGTCTCAAAAAAAAAGG - Intronic
921029170 1:211322303-211322325 AAAACCTGTATCACAATGAGAGG + Intergenic
921123047 1:212153260-212153282 AGACCCTGTCTCTAAAAAAGGGG + Intergenic
921191412 1:212712094-212712116 AGACTCTGTCTCAAAAATAATGG - Intergenic
921388384 1:214594653-214594675 AGATCCTGTCTCAAAAAGAAAGG - Intergenic
921664223 1:217848024-217848046 AGACGCTGTCTCAAAAAAAAAGG + Intronic
921727079 1:218535569-218535591 AGACCCTGTTTCAAAAATAAAGG - Intergenic
921911820 1:220557547-220557569 AGACTCTGTCTCAAAAAAAAAGG + Intronic
922148099 1:222968922-222968944 AAACTCTGTCTCAAAAAAAAAGG + Intronic
922208968 1:223472527-223472549 AGACCCTGTCTCCAAAAAAGAGG - Intergenic
922303698 1:224325722-224325744 AAATTCTGTCTCAAAAAGAAAGG + Intronic
922313678 1:224421578-224421600 AGACTCTGTCTCAAAAAAAAAGG + Intronic
922410899 1:225374097-225374119 AGACCCTGTCTCAAAAAAAAAGG + Intronic
922444194 1:225682776-225682798 AAACCCTGTCTCAAAATCCTCGG + Intergenic
922630716 1:227107428-227107450 AGACCCTGTCTCAAAAGGAAAGG - Intronic
922638418 1:227201154-227201176 AGATCCTGTCTCAAAAAAAAAGG - Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
922978920 1:229808654-229808676 AAAACCCGTCTCAAAAAAAAGGG - Intergenic
923191197 1:231622487-231622509 AGACCTTGTGTCAAAATGAGAGG - Intronic
923560711 1:235038644-235038666 AAACCCTGTCTCAAAAAAAAAGG + Intergenic
923577684 1:235174803-235174825 AGACTCTGTCTCAAAAAAAAAGG + Intronic
923597443 1:235371679-235371701 AAACTCTGTCTCAGAAAAAAAGG - Intronic
923709031 1:236370409-236370431 AAACTCTGTCTCCAAAAAAAAGG + Intronic
923709426 1:236374302-236374324 AGACCCTGTCTCAAAGAAGGAGG - Intronic
923727780 1:236522530-236522552 AAACCCTGTCTCAAAGTGGCGGG + Intronic
923757610 1:236807181-236807203 AGACCCTGCCTCAAAAAAAAAGG - Intronic
923788659 1:237092531-237092553 AGACTCTGTCTCAAAAAAAAAGG - Intronic
923789952 1:237103575-237103597 AAATTCTGTCTCAAAAAAACAGG - Intronic
923888838 1:238188530-238188552 AGACCCTGTCTCAAAAAGAAAGG - Intergenic
923933316 1:238728539-238728561 AAACGATGTTTCAAAAAGAGTGG - Intergenic
924126257 1:240855438-240855460 AGACCATGTCTCAAAAAAAAAGG - Intronic
924206150 1:241713299-241713321 AGACCCTGTCTCAAAAAGAAAGG + Intronic
924240939 1:242039596-242039618 AAACTGTGTCTCAAAAAAAAAGG + Intergenic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924504496 1:244669008-244669030 AGACCCTGTCTCACAAAAAAGGG - Intronic
924512939 1:244742633-244742655 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
924578252 1:245300425-245300447 AAACCCTTTTTAAAAAGGAGAGG - Intronic
924721082 1:246623750-246623772 AGACTCTGTCTCAAAAAAAAAGG + Intronic
924726119 1:246672613-246672635 AGACCCTGTCTCAAAAGAAAAGG + Intergenic
924733916 1:246737599-246737621 AGACCCTGTATCAAAAAAAAAGG - Intronic
924917137 1:248582740-248582762 AGACCCTGACTCAAAAATGGGGG - Intergenic
1063402359 10:5758525-5758547 AAACCCTGTCTCAAAAAAAAAGG + Intronic
1063403015 10:5766102-5766124 ACACGTTGTCTCAAAATGAGTGG + Exonic
1063567311 10:7182053-7182075 AGAGCCTGTCTCAAAAAAAAAGG - Intronic
1063587938 10:7369867-7369889 AAACCCTGTCTCAAACAAAAAGG - Intronic
1063598753 10:7461438-7461460 AGACCCAGTCTCAAAAAGGGAGG + Intergenic
1063711840 10:8486809-8486831 AGACCCTGTCTCAAAAAGGAAGG - Intergenic
1064047477 10:12030872-12030894 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1064198487 10:13264797-13264819 AGACCCTGTCTCAAAAAATAAGG - Intergenic
1064568932 10:16672298-16672320 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1064718518 10:18203339-18203361 AAACCCTTTTTCAGATAGAGGGG - Intronic
1065029643 10:21572628-21572650 AGACTCTGTCTCAAAAAAACAGG - Intronic
1065067279 10:21983043-21983065 AGACTCTGTCTCAAAAACAAAGG + Intronic
1065240574 10:23699632-23699654 AAACCCAGTCTCTAAAAAAAAGG - Intronic
1065372052 10:24997394-24997416 AGACCCTGTCTCAAAAAAAGAGG - Intronic
1065521410 10:26577132-26577154 AAACTCTGTCTAAAAAAAAATGG - Intergenic
1065620104 10:27572152-27572174 ACACCCTGTCTCTAAAAAAGGGG - Intergenic
1065690882 10:28332669-28332691 AGACCCTATCTCAAAAAATGGGG - Intronic
1065695924 10:28379681-28379703 AGACCCTGTCTCAATAAAAAGGG - Intergenic
1065745524 10:28837651-28837673 AGACCCTGTCAGAAAAGGAGAGG + Intergenic
1065788852 10:29241757-29241779 AGACCCTGCCTCAAGAAGAAGGG + Intergenic
1065824455 10:29557103-29557125 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1065837722 10:29674319-29674341 AGATTCTGTCTCAAAAAAAGTGG + Intronic
1065849732 10:29777704-29777726 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1065851479 10:29793581-29793603 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1065855015 10:29823089-29823111 AGACCTTGTCTCAAAAAAAATGG - Intergenic
1065956127 10:30695112-30695134 AGACCCTTTCTCAAAAAAAACGG + Intergenic
1066106472 10:32161522-32161544 AGACCTTGTCTCAAAAAAAAGGG + Intergenic
1066361828 10:34738741-34738763 AGACCCTGTCTTAAAAAAACAGG + Intronic
1066361842 10:34738800-34738822 AGACCCTGTCTCAAAATAAGGGG + Intronic
1066421401 10:35267934-35267956 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1066536621 10:36398712-36398734 AAACTCTGTCTCAAAAAACGAGG + Intergenic
1066673912 10:37868170-37868192 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1066680384 10:37932113-37932135 AAACTTTGTCTCAAAAAAAAGGG - Intergenic
1066779038 10:38922546-38922568 AAACTCTATCTCAAAAAAAAAGG + Intergenic
1067002911 10:42634385-42634407 CAACTCTGTCTCAAAAAAAAAGG + Intronic
1067129827 10:43553256-43553278 AGACCCTGTCTCAAAGAAAAGGG - Intergenic
1067238785 10:44473063-44473085 AAACCCTACCTCCAAAAGGGAGG - Intergenic
1067326771 10:45275911-45275933 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1067419867 10:46135754-46135776 AAACTCCGTCTCAAAAAAAAAGG + Intergenic
1067426151 10:46213657-46213679 AAACTCCGTCTCAAAAAAAAAGG - Intergenic
1067505217 10:46842351-46842373 AAACTCCGTCTCAAAAAAAAAGG + Intergenic
1068308534 10:55248578-55248600 AGACTCTGTCTCAAAAAAAAGGG - Intronic
1068549147 10:58386053-58386075 AAACCCTGTCCTAAACGGAGGGG - Intronic
1069296104 10:66846120-66846142 AGACTCTGTCTCAAAAAAAAGGG + Intronic
1069531347 10:69221899-69221921 AGACCCTGTCTGAAAAAAAAAGG + Intronic
1069673364 10:70229917-70229939 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1069883342 10:71607891-71607913 AAACTCTGTCTCAAAACAAAAGG + Intronic
1069945500 10:71982736-71982758 TGACCCTGTCTCAAAAAAAAAGG + Intronic
1069970394 10:72162931-72162953 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1069998099 10:72355335-72355357 AAACCATGCCTCACAAACAGTGG - Intergenic
1069998914 10:72361544-72361566 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1070108975 10:73463938-73463960 AGACTCTGTCTCAAAAAAAGAGG - Intronic
1070115821 10:73527942-73527964 AAACTCCATCTCAAAAAGAATGG - Intronic
1070125820 10:73620853-73620875 AAACTCTGTCTCAAACAAACAGG + Intronic
1070867641 10:79716260-79716282 AGACCCTGTCTCAAAACGTGGGG - Intergenic
1071044254 10:81354583-81354605 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1071254721 10:83861537-83861559 AGACCCTGTCTCAAAAAATAAGG + Intergenic
1071329429 10:84545116-84545138 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1071365575 10:84897110-84897132 AAAAACTGTCTCAAAATGACAGG + Intergenic
1071634551 10:87238482-87238504 AGACCCTGTCTCAAAATTTGGGG - Intergenic
1071660693 10:87499539-87499561 AGACCCTGTCTCAAAACGTGGGG + Intergenic
1071687575 10:87776476-87776498 AGACCCTGTCTCAAAAAAAAGGG - Intronic
1071698643 10:87904763-87904785 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1072098517 10:92206441-92206463 AGACCCTGTCTCAAAACGAAAGG - Intronic
1072442791 10:95471709-95471731 AGATCCTGTGTCAAAAAGAAAGG + Intronic
1072444318 10:95484962-95484984 AGACCCTGTCTCAAATAGAAAGG + Intronic
1072661886 10:97368365-97368387 AGACTCTGTCTCAAAAAAAAGGG - Intronic
1072759039 10:98040753-98040775 AGACCCTGTCTCAAAAAGAGAGG + Intergenic
1072911442 10:99505235-99505257 AGACTCTGTCTCAAAAAAAGGGG + Intergenic
1073149819 10:101304076-101304098 AGACCCTGTCTCAAAAAAAGAGG - Intergenic
1073182124 10:101590041-101590063 AGACCCTGTCTCAAAAAAACTGG + Intronic
1073364538 10:102927741-102927763 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1073373210 10:103009264-103009286 AAACTCCGTCTCAAAAAAAACGG + Intronic
1073422172 10:103433485-103433507 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1073437783 10:103531540-103531562 AGACCCTGTCTCAAAAAAAGTGG - Intronic
1074126667 10:110533990-110534012 AGACTCTGTCTCAAAAAGAAAGG + Intergenic
1074159688 10:110827376-110827398 AGACCCTGTCTCAGAAAAAAAGG + Intronic
1074448024 10:113536536-113536558 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1074553510 10:114467147-114467169 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1074897259 10:117787842-117787864 AAACCCTCTATCAAAAAAAAAGG + Intergenic
1075699032 10:124456641-124456663 AGACCCTGTCTCAGAAAGGAAGG + Intergenic
1076024856 10:127102828-127102850 AAACTCAGTCTCAAAAAAAAAGG + Intronic
1076910072 10:133383174-133383196 AAACTCCGTCTCAAAAAAAAAGG + Intronic
1076987174 11:246489-246511 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1077052015 11:571155-571177 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1077082802 11:732547-732569 AGACGCTGTCTCAAAAAAAAAGG + Intergenic
1077087248 11:759925-759947 ACACCCAGTCTCACAAACAGAGG - Intronic
1077099050 11:813353-813375 AAACCCTGTCTTGAAAAAAAAGG + Intergenic
1077449395 11:2627758-2627780 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1077622716 11:3741609-3741631 AAACTCCGTCTCAAAAAAAAAGG + Intronic
1077810009 11:5627369-5627391 AAACTCCGTCTCAAAAAAAAAGG + Intronic
1077938440 11:6814664-6814686 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1077960232 11:7069233-7069255 ATACCCTGTCTCATAATTAGTGG + Intronic
1078126922 11:8575032-8575054 AGACCCTGTCTCAAAAAAAGGGG + Intronic
1078195710 11:9135080-9135102 AGACCCTGTCTCAAAGAAAAGGG + Intronic
1078875329 11:15389226-15389248 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1078901198 11:15644298-15644320 AGACCCTGTCTTAAAAAAAGGGG - Intergenic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079000804 11:16753744-16753766 AGAACCTGTCTCAAAAAAGGGGG - Intronic
1079061756 11:17255058-17255080 AAACTCTGTCTGAAAAAAAAAGG - Intronic
1079249635 11:18777933-18777955 AGACCCTGTCAGAAAAAGAAAGG + Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080010367 11:27453076-27453098 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1080652415 11:34233259-34233281 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1081369893 11:42286723-42286745 AAACTCCGTCTCAAAAAAAAAGG + Intergenic
1081495781 11:43608936-43608958 AGGCCCTGTCTCAAAAAAAGAGG - Intronic
1081579138 11:44339974-44339996 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1081783624 11:45731057-45731079 AAACTCTGTCTCAAAAAAAGAGG - Intergenic
1081801883 11:45865733-45865755 TGACCCTGTCTCAAAAAAAAGGG + Intronic
1081854007 11:46292634-46292656 AGACCCTGTCTCTAAAAAACGGG - Intronic
1082011171 11:47450367-47450389 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1082015503 11:47483253-47483275 AGACCCCATCTCAAAAAAAGGGG + Intronic
1082781615 11:57292631-57292653 AAACCATGTCTCAAAAAAAAAGG + Intergenic
1082855702 11:57804906-57804928 AGACTCTGTCTCAAAAATAAGGG - Intronic
1082863717 11:57879219-57879241 AAACTCTATGTTAAAAAGAGAGG + Intergenic
1082879626 11:58025182-58025204 AGACTCCGTCTCAAAAAGAAAGG - Intronic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1083238180 11:61365717-61365739 AAACCCTGTCTCGAAAAATAAGG + Intronic
1083256699 11:61500729-61500751 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1083305434 11:61759658-61759680 AAACTTTGTCTCAAAAAGAAAGG + Intronic
1083338630 11:61944271-61944293 AGACCCTGTCTCAACAAAGGAGG - Intergenic
1083373679 11:62202569-62202591 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1083399704 11:62415080-62415102 AAACTCCGTCTCAAAAAAAAAGG - Intronic
1083411090 11:62492866-62492888 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1083535682 11:63464644-63464666 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1083612923 11:64012843-64012865 AGACCCTGTCTCAAAAAACAAGG - Intronic
1083649567 11:64193774-64193796 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1083761752 11:64822480-64822502 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1083792482 11:64994853-64994875 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1083809325 11:65094785-65094807 AAACCCAGTCTCAAAAAAAAAGG + Intronic
1083991904 11:66251484-66251506 AGACTCCGTCTCAAAAAAAGAGG + Intergenic
1084301180 11:68253702-68253724 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1084307667 11:68297609-68297631 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1084340510 11:68496349-68496371 AGACCCCGTCTCAAAAAGGAAGG - Intronic
1084439702 11:69165841-69165863 AGACCCTGTCTCAAAACGTAAGG - Intergenic
1084532439 11:69735745-69735767 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1084601889 11:70150542-70150564 AGACCCTGTCTCCCAAAAAGTGG - Intronic
1084845407 11:71895316-71895338 AAACTCTGACTCAAAAAAAAAGG - Intronic
1085497577 11:76985140-76985162 AGACCCTGTCTCCAAAAAAGAGG - Intronic
1085636715 11:78164785-78164807 AAACTCCGTCTCAAAAAAAAGGG - Intergenic
1085719381 11:78899541-78899563 GCACTCTGTCTCAAAAAGCGGGG + Intronic
1086084052 11:82936965-82936987 CGACCCTGTCTCAAAAAAACTGG + Intronic
1086128123 11:83370814-83370836 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1086159005 11:83700250-83700272 CCACTCTTTCTCAAAAAGAGAGG - Intronic
1086332182 11:85765244-85765266 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1086387551 11:86325166-86325188 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1086470443 11:87103666-87103688 AGATCCTGTCTCAAAAAAAAAGG - Intronic
1086897874 11:92334363-92334385 AGACCCTGTCTCAATAAAAAGGG + Intergenic
1087301892 11:96445566-96445588 AAACTCTGTCTCAAAAAAAAAGG + Intronic
1087315584 11:96598780-96598802 AGACTCTGTCTCAAAAACAAAGG + Intergenic
1087533693 11:99416285-99416307 AAACCTTGTCTCAAAAAAAAAGG - Intronic
1087573075 11:99955567-99955589 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1087690524 11:101316467-101316489 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1088128444 11:106458334-106458356 AAGCTCTGTTTCAAAAACAGAGG - Intergenic
1088203881 11:107370290-107370312 CAAGCCTGTTTAAAAAAGAGGGG + Intronic
1088656373 11:112003787-112003809 AAGCTCTGTCTCAAAAAAAAAGG + Intronic
1088662666 11:112063499-112063521 AAATCCTGTCTGAAAAGGAGGGG + Exonic
1088889408 11:114032827-114032849 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1089470047 11:118713387-118713409 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1089481590 11:118809873-118809895 AGACCCTGTCTGAAAAAAAAAGG + Intergenic
1089513516 11:119016640-119016662 AAAGACTGTCTCAGAAAGGGGGG - Intronic
1089716809 11:120368084-120368106 AGACCCTGTCTCAAAAAAAGAGG - Intronic
1089781806 11:120878469-120878491 CAACACTGGCTCAAAAAGATGGG - Intronic
1089793588 11:120962389-120962411 AAACGTTGGCTTAAAAAGAGAGG - Intronic
1089871628 11:121678698-121678720 AAAATCTGTCTCAAAAATGGAGG - Intergenic
1090011376 11:123048603-123048625 AGACCCTGTCTCAAAAAAAGAGG + Intergenic
1090954333 11:131501221-131501243 AAATCCTGTCTGTCAAAGAGTGG + Intronic
1091493534 12:952881-952903 AAACTCTGTCTCAAAAGAAAGGG + Intronic
1092185163 12:6473423-6473445 AGACCCTGTCTCAAAAAAACGGG + Intergenic
1092341305 12:7678538-7678560 AGACTCTGTCTCAAAAAAAATGG + Intergenic
1092345692 12:7712880-7712902 AAAGCCTGTCTCAAAAATGTTGG - Intronic
1092345927 12:7714520-7714542 AAACTCCGTCTCAAAAAAAAAGG - Intronic
1092361848 12:7843340-7843362 AGGCGCTGTTTCAAAAAGAGTGG + Intronic
1092378063 12:7972026-7972048 AGGCGCTGTTTCAAAAAGAGTGG + Intergenic
1092431589 12:8413869-8413891 AAACTCTGACTCAAAAAAAAAGG + Intergenic
1092434544 12:8436490-8436512 AAACTCTGACTCAAAAAAAAAGG + Intergenic
1092720280 12:11434215-11434237 AAACCATGTCCCAGAGAGAGAGG + Intronic
1092825085 12:12391393-12391415 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1092849031 12:12610655-12610677 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1093030966 12:14288156-14288178 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1093222461 12:16439166-16439188 GAACCCTGTCACAAAACCAGAGG + Intronic
1093300387 12:17446180-17446202 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1093480366 12:19598310-19598332 AGACTCTGTCTCAAAAATAAAGG - Intronic
1094257637 12:28451868-28451890 AAACCCAGTCTCACACAGATAGG - Intronic
1094291956 12:28861094-28861116 AGACCCTGCCTCAAAAAAAACGG - Intergenic
1094394292 12:29989322-29989344 AGACCCTATCTCAAAAAAAATGG - Intergenic
1094458356 12:30664749-30664771 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1094653897 12:32402386-32402408 AGACCCTGTCTCAAAAAGAGAGG + Intronic
1094672407 12:32583325-32583347 AAACCCTGTCTCAAAAAACAAGG + Intronic
1095428616 12:42107679-42107701 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1095453441 12:42356163-42356185 AACCCCAGTCTCATAGAGAGTGG + Intronic
1095502172 12:42851785-42851807 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1095774179 12:45994123-45994145 AGACCCTGTCTCAACAAAAAGGG + Intergenic
1096209796 12:49756141-49756163 AGACACTGTCTCAAAAAAAAAGG - Intronic
1096365815 12:51027327-51027349 AAACCCTGTCTCAAAAAAAAAGG + Intronic
1096366112 12:51029702-51029724 AGACCCTGTCTCAAAAAAGTGGG + Intergenic
1096369393 12:51056392-51056414 AAACGATGTCTCAACAAGGGAGG - Exonic
1096420067 12:51449413-51449435 AGACCCTATCTAAAAAAGAAAGG + Intronic
1096490867 12:52012260-52012282 AAACTCCATCTCAAAAAAAGTGG - Intronic
1096704424 12:53409998-53410020 AGACACTGTCTCAAAAAAAAAGG + Intronic
1096831679 12:54319473-54319495 AAACTCCGTCTCAAAAAAAAAGG - Intronic
1097012588 12:55963996-55964018 AAACCCTGTATCAAAAGGAAAGG - Intronic
1097018826 12:56005938-56005960 AGATTCTGTCTCAAAAAAAGGGG + Intronic
1097062106 12:56292892-56292914 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1097065364 12:56316555-56316577 AGACTCCGTCTCAAAAAAAGGGG - Exonic
1097159076 12:57033361-57033383 AAACCCTGTCTCAAAAAAAGAGG - Intronic
1097437280 12:59565832-59565854 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1097869435 12:64588088-64588110 AGACCATGTCTCAAAAAAAAAGG - Intergenic
1097877998 12:64661471-64661493 AGACCCTGTCTCTAAAAAAAAGG + Intronic
1097882472 12:64698755-64698777 AAACTCTATCTCAAAAAAAAAGG - Intergenic
1097955501 12:65481541-65481563 AAACCCTGTCTCTACAAGACAGG + Intronic
1098020492 12:66150422-66150444 AGACCCTGTCTTAAAAAGAAAGG - Intronic
1098254776 12:68606033-68606055 AGACTCTGTCTCAAAAAAAGAGG + Intergenic
1098257787 12:68635465-68635487 TGACTCTGTCTCAAAAAAAGAGG - Intronic
1098271994 12:68778109-68778131 AGATCCTGTCTCAAAAAAAAGGG + Exonic
1098273575 12:68792021-68792043 AGATCCTGTCTCAAAAAAACAGG - Intronic
1098282272 12:68873813-68873835 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1098772237 12:74567298-74567320 AAACCCTATCTCACAAATCGTGG + Intergenic
1099293931 12:80806222-80806244 CAACTCTTTCTCAAAAAAAGTGG + Intronic
1099381133 12:81954229-81954251 AGACCTAGTGTCAAAAAGAGAGG - Intergenic
1099567070 12:84264806-84264828 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1099727676 12:86454235-86454257 AGACCCTGTCTTAAAAAAAAAGG - Intronic
1099814257 12:87624947-87624969 AGACCCTGTCTCACAAAAAAAGG + Intergenic
1100520647 12:95372138-95372160 AGACCCTGTCTGAAAAACACAGG - Intergenic
1100571837 12:95850114-95850136 AGACCCCGTCTCAAAAAAACGGG + Intergenic
1100576159 12:95893363-95893385 AAAACCTGTCTCAAAAAAGAAGG - Intronic
1100623542 12:96305724-96305746 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1100646057 12:96532628-96532650 AGATCCTGTCTCAAAAAAAAAGG - Intronic
1100722267 12:97371482-97371504 AAACTCCATCTCAAAAAAAGAGG + Intergenic
1100836119 12:98568747-98568769 AGACTCTGTCTCAGAAAGAGAGG + Intergenic
1100857071 12:98766822-98766844 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1101085385 12:101230389-101230411 AGACCCTGTCTCAAAAACAAAGG + Intergenic
1101369089 12:104108423-104108445 AAACCCCATCTCAAAAAAAAAGG + Intergenic
1101486194 12:105163509-105163531 AGACCCTGCCTCAAAAAGAAAGG - Intronic
1101852740 12:108417272-108417294 AGACCCTGTCTCAAAAGAAAAGG - Intergenic
1102022647 12:109694879-109694901 AGACCCTGTCTCAAAAAAAGGGG + Intergenic
1102137600 12:110588176-110588198 AGACCCTGTCTCAAAAAACGGGG + Intergenic
1102147684 12:110667141-110667163 AGACTTTGTCTCAAAAAGAAAGG - Intronic
1102188114 12:110965414-110965436 AGACCCTATCTCAAAAAAAAAGG - Intergenic
1102219514 12:111185052-111185074 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1102832914 12:116023285-116023307 GACCCCTGTCTCAAAAAAAGTGG + Intronic
1102915492 12:116749289-116749311 AGAGCCTGTCTCAAAAGGGGTGG - Intronic
1103452021 12:121035865-121035887 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1103479707 12:121243040-121243062 AAAATCTGTCTCAAAAAAAAAGG - Intronic
1103664045 12:122547364-122547386 AAACTCTGTCTCAAAAAAAAAGG + Intronic
1103829582 12:123768141-123768163 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1104032408 12:125074535-125074557 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1104193665 12:126509019-126509041 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1104309929 12:127645363-127645385 AGACTCAGTCTCAAAAAAAGAGG + Intergenic
1104604806 12:130180054-130180076 GAACCCTGTCTCATACAGTGTGG - Intergenic
1104825645 12:131707266-131707288 AGACCTTGTCTCAAAAAAATAGG - Intergenic
1105054965 12:133090147-133090169 AGATCCTGTCTCAAAAAAATAGG - Intronic
1105061827 12:133159909-133159931 AGACCCTGTCTCCAAAAAAGGGG + Intronic
1105302106 13:19144654-19144676 AGACCCTGTCTCCAAAAGAAAGG + Intergenic
1105358200 13:19679484-19679506 AGACCCTTTCTCAAAAAAAAAGG + Intronic
1105440124 13:20408056-20408078 AAACCCTGTCTCTAAAAAGCAGG - Intronic
1105492125 13:20899084-20899106 AGACCCTGTCTCAAAAGAAAGGG + Intronic
1105798243 13:23879533-23879555 AGACCCTGTCTCCAAAATAAGGG - Intronic
1105869408 13:24490895-24490917 TAACACTTTCTCAAAAAGATAGG + Intronic
1106002189 13:25734645-25734667 AAACTCCATCTCAAAAAGAAAGG - Intronic
1106058588 13:26263448-26263470 AAACTCTGGCTCAAAAAAAAAGG - Intronic
1106813561 13:33383367-33383389 AGACCCTGTGTCAAAAAAAAAGG + Intergenic
1107147450 13:37073713-37073735 AAACTCTATCTCAAAAAAAAAGG - Intergenic
1107321422 13:39192754-39192776 AGACCCTGTCTCAAAGAAAAGGG + Intergenic
1107366071 13:39678074-39678096 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1107828701 13:44354264-44354286 ATACTCTGTCTCAAAAAAAAAGG + Intergenic
1107919066 13:45184396-45184418 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1108345718 13:49545168-49545190 TAACCCCCTCTCAAAACGAGTGG + Intronic
1108360175 13:49662001-49662023 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1108366876 13:49724605-49724627 AGACCCTATCTCAAAAACAAAGG - Intronic
1108390488 13:49942874-49942896 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1108551806 13:51553693-51553715 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1110284642 13:73735286-73735308 AGACCCTGTCTCAAAAGAAAGGG + Intronic
1111047512 13:82833969-82833991 AAACTATGTATCAAAAAGAGGGG + Intergenic
1111535559 13:89598383-89598405 AGACCCTATCTCAAAAAAAAAGG - Intergenic
1111664387 13:91248969-91248991 AGACCCTGTCTCAAAAAACATGG - Intergenic
1111738687 13:92174856-92174878 AAACTCTGTCTCAAAAATGAAGG - Intronic
1112039430 13:95531538-95531560 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1112266138 13:97925499-97925521 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1112306852 13:98282127-98282149 AAACCCTGTCTCTAAAAAAATGG + Intronic
1112346618 13:98595267-98595289 AGACCCTGTCTAAAAAAAAAAGG + Intergenic
1112510895 13:100008225-100008247 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1112664447 13:101553783-101553805 AAACTCTGTCTCAAAAAAAGGGG - Intronic
1112771088 13:102795551-102795573 AGACCCTGTCTCAACAACAACGG + Intronic
1112865565 13:103892365-103892387 AAACCCAGTTTCACAAAGACAGG - Intergenic
1113105469 13:106767519-106767541 TACCCCTGTCCCAAAAGGAGAGG - Intergenic
1113330800 13:109325325-109325347 AAACCTTGACTAATAAAGAGAGG + Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1113707284 13:112443061-112443083 AAACACTGTGTTAAAAAGATGGG + Intergenic
1113746929 13:112751737-112751759 AGACCCTGTCTCAAAAAAAGGGG - Intronic
1113979747 13:114264547-114264569 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1114187015 14:20410430-20410452 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1114194241 14:20462865-20462887 AAACCCTGTCTAAAAAAATCAGG - Intergenic
1114194431 14:20464794-20464816 AGACCCTGTCTCTAAAAGCACGG - Intergenic
1114282531 14:21206468-21206490 AAACCCTGTGTGATAAAGAGGGG - Intergenic
1114290244 14:21282083-21282105 ATACTCTGTCTCGAAAAAAGAGG + Intergenic
1114456906 14:22861172-22861194 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1114471744 14:22967893-22967915 AGACTCTGTCTCAAAAAAAAGGG - Intronic
1114503199 14:23187356-23187378 AGACCTTGTCTCTAAAAAAGGGG - Intronic
1114761471 14:25321366-25321388 AAATCCTTTCCCAAAAAGATGGG - Intergenic
1115201687 14:30860780-30860802 AGACCCTGTCTCAAAAAAATCGG - Intergenic
1115254263 14:31381774-31381796 AGACCCTGTTTCAAAAAAAGGGG + Intronic
1115413317 14:33101430-33101452 AAACCCTGACTAGAAAAGGGTGG + Intronic
1115565853 14:34624923-34624945 AGACTCTGTCTCGAAAAGAAAGG - Intronic
1115621113 14:35141724-35141746 AGACCCTGTCAAAAAAAAAGTGG - Intronic
1115679146 14:35717157-35717179 AAACTCCGTCTCAAAAAAAATGG - Intronic
1115712021 14:36061388-36061410 AGACTCTGTCTCAAAAAAAGTGG - Intergenic
1115982895 14:39073298-39073320 AGACTCTGTTTCAAAAAGAAGGG - Intronic
1116869615 14:50059041-50059063 AAACTCTGTCTAAAAAAAAAAGG - Intergenic
1116970073 14:51054837-51054859 AGACTCCGTCTCAAAAAAAGAGG - Intronic
1117129893 14:52675642-52675664 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1117224749 14:53644139-53644161 AGACCTTGTCTCAAAAAAAAAGG - Intergenic
1117230106 14:53708175-53708197 AAACTCTGTCTCAAAAAAAAGGG + Intergenic
1117354755 14:54913180-54913202 AGACCCTGTCTCAAAAAGGAAGG + Intergenic
1117386097 14:55214456-55214478 AAACCACGTCTCAAAAAAAAAGG + Intergenic
1117388253 14:55238268-55238290 AAACCCCATCTCTAAAAAAGAGG - Intergenic
1117536154 14:56705119-56705141 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1117671939 14:58116959-58116981 AAACTCTGTCTCTAAAATAAAGG - Intronic
1117725797 14:58672398-58672420 AGACCCTGTCTCAAAAACAAAGG - Intergenic
1117820183 14:59640968-59640990 AGACCCTGTCTCAGAAGGAAAGG - Intronic
1117902757 14:60551770-60551792 ATCCCCTGTTTCAACAAGAGAGG - Intergenic
1117954541 14:61112423-61112445 AAGCTCTGTCTCAAACAGTGAGG - Intergenic
1118028854 14:61799825-61799847 AGACTCTGTCTCAAAAAAAGTGG - Intergenic
1118178786 14:63470079-63470101 AGACCTTGTCTCAAAAAAAGTGG - Intronic
1118279232 14:64413341-64413363 AAACTCCGTCTCAAAAAAATAGG + Intronic
1118334710 14:64843053-64843075 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1118403466 14:65400873-65400895 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1118798748 14:69169579-69169601 AGACTCTGTCTCAAAAAAAGAGG - Intergenic
1118834565 14:69467756-69467778 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1119064402 14:71511294-71511316 AGACCCTGTCTCAAAAGGAAAGG - Intronic
1119064972 14:71516394-71516416 AGACCCTGTCTCAGAAAAAAAGG - Intronic
1119199857 14:72744280-72744302 AGGCCCTGGCTCAAAAAAAGTGG - Intronic
1119289371 14:73482663-73482685 AAACTCTGTCTCAAAAAATAAGG - Intronic
1119292775 14:73508853-73508875 AGACCCTGTCTCTAAAAAAAAGG - Intronic
1119298973 14:73555994-73556016 AAACTCTATCTCAAAAAAAAAGG + Intronic
1119378997 14:74216976-74216998 AGACCCTGTCTCTAAAAAACGGG + Intergenic
1119494590 14:75067987-75068009 AGGCCCTGTCTCAAAAACAAAGG + Intronic
1119508620 14:75193747-75193769 AGACTCTGTCTCAAAAAGAGAGG + Intergenic
1119590314 14:75880921-75880943 AGACCCTGTCTCAAAAAAAGCGG - Intronic
1119722871 14:76903017-76903039 AGACCCTGTCTCAGAAAGCGTGG + Intergenic
1119763519 14:77172423-77172445 AGAATCTGTCTCAAAAAGAAAGG + Intronic
1119809872 14:77508036-77508058 AGACCCTGGCTCAATAAGAGGGG - Exonic
1119904653 14:78290627-78290649 AGACCTTGTCTCAAAAAAAAAGG + Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1120877194 14:89385796-89385818 AAACTCTGTCTCAAAAAACAAGG + Intronic
1121084655 14:91136671-91136693 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1121091526 14:91186254-91186276 AGACTCTGTCTCAAAAAAAGGGG - Intronic
1121130493 14:91441446-91441468 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1121146150 14:91584072-91584094 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1121147362 14:91596211-91596233 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1121194272 14:92055949-92055971 AGGCCCTGTCTCAAAAAAAAAGG + Exonic
1121340593 14:93102778-93102800 AAACCCTGTCTCTACAACAACGG + Intronic
1121365243 14:93303001-93303023 AGATCCTATCTCAAAAAAAGAGG + Intronic
1121532830 14:94670626-94670648 AGAGCCTGTCTCAAACAGGGAGG + Intergenic
1121726933 14:96159097-96159119 AGACTCTGTCTCAAAAAAAGGGG - Intergenic
1121767305 14:96499077-96499099 AGACCATGTCTCAAAAATAAAGG - Intergenic
1122095332 14:99366405-99366427 AAACTCTGTCTCAAAAAAAAGGG - Intergenic
1122161856 14:99790865-99790887 AGACCCTGTCACAAAAAAAAAGG - Intronic
1122186007 14:99996659-99996681 AGACCCTGCCTCAAAAAAAAAGG - Intronic
1122221564 14:100241963-100241985 AGACTCTGTCTCAAAAGGGGGGG + Intronic
1122229111 14:100296417-100296439 AGACCGTGTCTCAAAAAAAAAGG + Intronic
1122467116 14:101941312-101941334 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1122494821 14:102145607-102145629 AAACCCTGTCTCTACAAGGGTGG + Intronic
1122732008 14:103807502-103807524 ATACTCTGTCTCAAAAAAAAGGG - Intronic
1122958007 14:105080879-105080901 AAACTCTGTCTTAAAAAAAAAGG - Intergenic
1122966726 14:105133156-105133178 AGACCATGTCTGAAAAAGAAAGG - Intergenic
1123668531 15:22629578-22629600 AGACTCTGTCTCAAAAAACGGGG + Intergenic
1123712883 15:23002988-23003010 AGACCCTGTCTCTAAAAAAAAGG + Intronic
1123715779 15:23029869-23029891 AGACTCCGTCTCAAAAAAAGGGG + Intronic
1123797222 15:23783896-23783918 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1123900213 15:24869133-24869155 ATACCGTGTCTCAAAAAAAATGG + Intronic
1123901338 15:24880274-24880296 AGACCTTGCCTCTAAAAGAGGGG + Intronic
1123901391 15:24880751-24880773 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1123911724 15:24974732-24974754 AAACCCTGTTTCTAATAAAGAGG - Intronic
1123930342 15:25166814-25166836 AGACTCTGTCTCAAAAAAACAGG + Intergenic
1124096661 15:26654749-26654771 AGACCTTGTCTCAAAAAAAGGGG + Intronic
1124223822 15:27871618-27871640 AAAGCCTGTCTGAGAAGGAGTGG - Intronic
1124266160 15:28236297-28236319 AGACTCCGTCTCAAAAGGAGAGG - Intronic
1124524508 15:30436040-30436062 AGACTCTGTCTCAAAAAACGGGG + Intergenic
1124534158 15:30530183-30530205 AGACTCTGTCTCAAAAAACGGGG - Intergenic
1124575972 15:30908830-30908852 AAACTCTGTCTCAAAAAAAATGG + Intronic
1124764490 15:32477428-32477450 AGACTCTGTCTCAAAAAACGGGG + Intergenic
1124774142 15:32571670-32571692 AGACTCTGTCTCAAAAAACGGGG - Intergenic
1124824175 15:33077036-33077058 AGACTCTGTCTCAAAAAAATTGG - Intronic
1125195582 15:37042139-37042161 AGACCCTATCTCAAAAAGAAAGG + Intronic
1125533935 15:40432117-40432139 AAACCCTGTCTCTACAGGTGTGG - Intronic
1125559055 15:40612480-40612502 AGACTCTGTCTCCAAAAAAGAGG + Intronic
1125569746 15:40707314-40707336 AGACTCTGTCTCAAAAAAAAGGG - Intronic
1125592843 15:40865519-40865541 AGACCCTGTCTCAAAACAAAAGG + Intergenic
1125669406 15:41459364-41459386 AGACCCTGTGTCAAAAAAAAGGG + Intronic
1125810009 15:42530738-42530760 AGACCCTTTCTCAAAAAGAAAGG + Intronic
1125904135 15:43374910-43374932 AGACTCTGTCTCAAAAAAAGTGG - Intronic
1125965045 15:43867361-43867383 AAACCCAGTCTGAAAAACACAGG - Exonic
1126000459 15:44205001-44205023 AGACCCTGTCTCGAAAAAAAAGG + Intergenic
1126142076 15:45446943-45446965 AGATCCTGTCTCAAAAAAAATGG - Intronic
1126168244 15:45672001-45672023 AAAACCTGCGTCAAAAAGGGTGG - Intronic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1126606849 15:50486477-50486499 AGACCCTGTCTCAAACAAAAGGG + Intronic
1126611095 15:50530271-50530293 AGACCCTGTCTCTAAAAAAAAGG + Intronic
1126638484 15:50802218-50802240 AGACCCTGTCTCTAAAAAAACGG + Intergenic
1126642203 15:50839586-50839608 AAACTTTTTCTAAAAAAGAGAGG - Intergenic
1126726858 15:51640618-51640640 AGACCCTGTCTAAAAAAAAAAGG + Intergenic
1126858861 15:52864737-52864759 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1126876348 15:53045699-53045721 AGACCCTGTCTCAAAAAAAGGGG - Intergenic
1127243431 15:57144606-57144628 AGAAGCTGTCTCAAAAAGAGAGG - Intronic
1127275731 15:57442142-57442164 GAACCCTGTCCCAAATTGAGTGG + Intronic
1127426308 15:58862226-58862248 AGACCCTGTGTCAAAAAAAAAGG + Intergenic
1127474246 15:59317668-59317690 AAACCCTGTGTAAGAAAGGGAGG + Intronic
1127500722 15:59551582-59551604 AGACTCTGTCTCAAAATAAGAGG + Intergenic
1127630529 15:60823197-60823219 AAACCCTGTCTCAGAAAGGAAGG - Intronic
1127883645 15:63179739-63179761 AGACTCCGTCTCAAAAAAAGAGG - Intergenic
1127942319 15:63711303-63711325 ATATCCTGTCTCAAAAAAAAGGG + Intronic
1128119474 15:65134841-65134863 GGACTCTGTCTCAAAAAAAGTGG - Intergenic
1128209465 15:65885051-65885073 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1128297283 15:66534109-66534131 AGACCCTGTTTCAAAAAAAAGGG + Intronic
1128583498 15:68826471-68826493 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1128637641 15:69313488-69313510 AGACTCTGTCTCAAAAACAGCGG + Intronic
1128932734 15:71720064-71720086 GGACCCTGTCTCAAACAGAGTGG - Intronic
1128986396 15:72224844-72224866 AAACTCTGTCTCAGAAAAAAAGG + Intronic
1129083917 15:73068232-73068254 AGACACTGTCTCAAAAAAAAAGG - Intronic
1129390559 15:75218544-75218566 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1129713076 15:77831268-77831290 AAACTCTGTATCAAAAAAAAGGG - Intergenic
1129830178 15:78663917-78663939 AGACCCTGTCTTAAAAAGGGAGG + Intronic
1129969372 15:79763956-79763978 AGACCCCATCTCAAAAAGAGGGG + Intergenic
1129970611 15:79774834-79774856 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1130178733 15:81604148-81604170 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1130347882 15:83066288-83066310 AGACCTTGTCTCAAAAAAAGCGG + Intronic
1130371844 15:83291443-83291465 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1130574045 15:85074663-85074685 GGAACCTGTCTCAAAAAGATGGG + Intronic
1130796570 15:87215955-87215977 AAACTCCATCTCAAAAAAAGAGG - Intergenic
1131140320 15:89971962-89971984 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1131163325 15:90124191-90124213 AAACTCCGTCTCAAAAAAAAAGG - Intergenic
1131168041 15:90156786-90156808 AAACTCTGTCTCAAAAAGGAAGG + Intergenic
1131240344 15:90736272-90736294 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1131548673 15:93337855-93337877 AGACCCTGTCTCAAATAAAGAGG - Intergenic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1131742608 15:95410696-95410718 AAACTCTGTCTAAAAAAAAATGG + Intergenic
1131788534 15:95938799-95938821 AAACTCTGTCTCAAAAAGAAAGG + Intergenic
1131803005 15:96091301-96091323 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1132043546 15:98545965-98545987 AGACCCTGTCTAAAAAAAAAAGG + Intergenic
1132161060 15:99543263-99543285 TGACCCTGTCTCAAAAAAAAAGG + Intergenic
1132258101 15:100395835-100395857 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1132494859 16:257808-257830 AGACCCTGTCTCTAAAATAAGGG + Intronic
1132537227 16:488368-488390 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1132755684 16:1483680-1483702 AAACTCTGTCTCAAAACAACAGG + Intergenic
1133252547 16:4493034-4493056 AGACTCTGTCTCAAAAAAAGAGG - Intronic
1133280246 16:4660989-4661011 AGCCCCTGTCTCAAAAAAAGGGG - Intronic
1133404565 16:5512923-5512945 AGACCCTGTCTCAAAAAACAAGG - Intergenic
1133612262 16:7444540-7444562 AAACCCTGTCTCAAAAAAAAAGG - Intronic
1133696725 16:8271094-8271116 AGACCCTGTCTCAAGAAAAAAGG + Intergenic
1133761148 16:8799159-8799181 AAACCCTATATAAATAAGAGTGG + Intronic
1134149306 16:11793521-11793543 AGATCCTGTCTCAAAAAAAAGGG + Intronic
1134162605 16:11903679-11903701 AGACCCTGTCTCCAAAAAAAAGG + Intronic
1134420043 16:14078430-14078452 AGACCCCGTCTCTAAAAAAGGGG - Intronic
1134442672 16:14308505-14308527 AGACACTGTCTCAAAAAAAAGGG - Intergenic
1134455114 16:14389753-14389775 AGACCCTGTCTCAAAACAAAAGG - Intergenic
1134467417 16:14491760-14491782 AGACCCTATCTCAAAAAAAAAGG + Intronic
1135024395 16:18988017-18988039 AAACCCTGTCTCTAAAAACAAGG - Intronic
1135027535 16:19010161-19010183 AAACTGTGTCTCAAAAGGAGAGG - Intronic
1135080515 16:19430683-19430705 AGACCCCATCTCAAAAAGAAGGG - Intronic
1135104228 16:19633524-19633546 AGACCCTGTTTCAAAAAAAAAGG - Intronic
1135290868 16:21236939-21236961 AAACTATGTGTCCAAAAGAGGGG - Intronic
1135304340 16:21355540-21355562 AAAACATGACTCAAAAAGAATGG - Intergenic
1135315659 16:21442461-21442483 AAACCCTGTCTCTAAAAACAAGG + Intronic
1135368585 16:21874722-21874744 AAACCCTGTCTCTAAAAACAAGG + Intronic
1135380918 16:21995605-21995627 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1135443232 16:22496420-22496442 AAACCCTGTCTCTAAAAACAAGG - Intronic
1135449015 16:22541787-22541809 AAACCCTGTCTCTAAAAACAAGG - Intergenic
1135524891 16:23206603-23206625 AGACCCTGTCTCAGAGAGAGAGG + Intronic
1135559056 16:23461236-23461258 AGACCCTGTCTCCAAAAAGGCGG - Intergenic
1135722191 16:24827376-24827398 AGACCCAGTCTCAAAAAGTTGGG + Intronic
1135747156 16:25027024-25027046 AGACTCTGTCTCAAAAATACAGG - Intergenic
1135777699 16:25271313-25271335 AGACCCTGTCTAAAAAAAAAAGG + Intergenic
1135801513 16:25501312-25501334 AAACCATGTCTAAAAAAAAGGGG + Intergenic
1135857507 16:26025496-26025518 AAACTCTGTTTCAAACAAAGTGG - Intronic
1135908484 16:26537456-26537478 AAACTCTGTCTAAAAAAAAAGGG + Intergenic
1136026635 16:27472924-27472946 AGACCCTGGCTCAAAAAAAAAGG - Intronic
1136145650 16:28314968-28314990 AAACTCCGTCTCAAAAAAAAGGG + Intronic
1136301084 16:29334670-29334692 AAAACATGACTCAAAAAGAATGG - Intergenic
1136312341 16:29421205-29421227 AAACCCTGTCTCTAAAAACAAGG + Intergenic
1136325769 16:29522940-29522962 AAACCCTGTCTCTAAAAACAAGG + Intergenic
1136340544 16:29640235-29640257 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1136440458 16:30262923-30262945 AAACCCTGTCTCTAAAAACAAGG + Intergenic
1136506167 16:30704830-30704852 AGATCCTGTCTCAAAAAAAAAGG + Intronic
1136535409 16:30896497-30896519 GAATCCTGTCTCAAAAGGGGGGG + Intergenic
1136574507 16:31115538-31115560 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1136611614 16:31369963-31369985 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1136633497 16:31503992-31504014 AGACCCTGTCTCAAAGAAAAAGG - Intronic
1137331249 16:47498891-47498913 AGACCCTGTCTCAAAACAAAAGG + Intronic
1137465304 16:48702936-48702958 AGACCTTGTCTCAAAAGGAAGGG - Intergenic
1137630416 16:49939395-49939417 AAACTCTGTCGCAAAAAAAAAGG + Intergenic
1137649610 16:50108649-50108671 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1138608030 16:58101135-58101157 AAACTCTGTTTCAAAAAAAAGGG - Intergenic
1138746380 16:59367539-59367561 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1138820276 16:60251046-60251068 AAACACTGTCGCAATAAGAAGGG + Intergenic
1139093186 16:63674242-63674264 AGACTCTGTCTCAAAAAAAGAGG - Intergenic
1139205558 16:65025344-65025366 AGACTCTGTCTCATAAAGAGGGG - Intronic
1139363600 16:66419242-66419264 AGACTCTGTCTCAAAAACAGAGG + Intergenic
1139437711 16:66946160-66946182 AGACCCTGCCTCAAAAAAATAGG + Intergenic
1139577551 16:67851468-67851490 AGACCCTGTCTCAAAAAACAAGG + Intronic
1139577652 16:67852291-67852313 AGACCCTGTCTCCAAAAAAAAGG + Intronic
1139828936 16:69781016-69781038 AGACCCTGTCTCAAAAAAACAGG + Intronic
1139873860 16:70129351-70129373 AAGCTCTGTCTCCAAAAAAGGGG - Intronic
1139886967 16:70215259-70215281 AAACCCTGTCTCTAAAAACAAGG + Intergenic
1139890491 16:70250806-70250828 AAACCCTGTCTCTAAAAAAAAGG + Exonic
1140020402 16:71233041-71233063 AAACACCGTCTCAAAAAAAAGGG + Intergenic
1140037415 16:71382001-71382023 AGACCCTGTCTCAAAAGAGGAGG + Intronic
1140087651 16:71810922-71810944 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1140101840 16:71924576-71924598 AGACCCTGTCTCAAAATCAAAGG + Intronic
1140127691 16:72131853-72131875 AGACTCTGTCTCATAAAAAGTGG - Intronic
1140157378 16:72445745-72445767 AAACCCTTTCTCAAAAAAGGGGG - Intergenic
1140381877 16:74496256-74496278 AGATCCTGTCTCAAAAATTGGGG + Intronic
1140419310 16:74804986-74805008 AGACCCTATCTCAAAAGGAAAGG - Intergenic
1140440366 16:74983461-74983483 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1140508553 16:75490467-75490489 AAACTCCGTCTCAAAAAAAAAGG + Intronic
1140666140 16:77229436-77229458 AAACTCTGTTTCAAAAAAAAGGG - Intergenic
1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG + Intronic
1141117933 16:81326522-81326544 AAACTCCGTCTCAAAAAAAAAGG + Intronic
1141152868 16:81576392-81576414 AGACTCTGTCTCAAAAAACGGGG + Intronic
1141402132 16:83758225-83758247 AAACCTTGTCTCATAAAAAGAGG - Intronic
1141558723 16:84853055-84853077 AGACCCTGTCTCAAAAATTAAGG + Intronic
1141585768 16:85032638-85032660 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1141588497 16:85051134-85051156 AGACCCTGTCTTAAAAAAAAAGG + Intronic
1141637941 16:85324975-85324997 AGACCTTGTCTCAAAAAAAACGG - Intergenic
1141640847 16:85340338-85340360 AGACCCTGTCTTAAAAACAAAGG + Intergenic
1141710096 16:85693719-85693741 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1141956784 16:87377438-87377460 AGACCCTGTCTCAAAAAAGTTGG + Intronic
1142062786 16:88041407-88041429 AAAACATGACTCAAAAAGAATGG - Intronic
1142162231 16:88563846-88563868 AAACCCCGTCTCAAAAATGTGGG + Intergenic
1142169472 16:88613919-88613941 AGACCCTGTCTCAAAAAAAGGGG + Intronic
1142297440 16:89234903-89234925 AGACTCTGTCTCAAAAAAAAAGG + Exonic
1142329274 16:89440602-89440624 AAACTCTGTCTCAAAAGGAGGGG + Intronic
1142527485 17:554410-554432 AAACTCCGTCTCAAAAAAAAAGG - Intronic
1142531971 17:585630-585652 AGACTCTGTCTCAAAAAAGGAGG + Intronic
1142584155 17:960351-960373 AGACCCTGTCACAAAAAAAAGGG - Intronic
1142736100 17:1900774-1900796 AGACCCTATCTCAAAAAAAGGGG + Intergenic
1142795177 17:2302241-2302263 AGACCCTGCCTCAAAAAAATTGG + Intronic
1142803346 17:2358700-2358722 AGACCCGGTCTCAAAAAAAACGG + Intronic
1142908544 17:3066450-3066472 AGACCCTGTCTCAAAAAAAATGG + Intergenic
1143005652 17:3831560-3831582 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1143196447 17:5079495-5079517 AGACCCTGTCTCAGAAAAAAGGG + Intronic
1143361109 17:6372076-6372098 AGACCCTATCTCAAAAAGAAAGG + Intergenic
1143559576 17:7685454-7685476 AAACTCCGTCTCAAAAAAAAGGG - Intronic
1143745860 17:8993785-8993807 AAACCCTGTCTCAAAAAACAAGG + Intergenic
1143967207 17:10764619-10764641 AAACTCTGTCTCAAATAAAAAGG - Intergenic
1144261287 17:13524265-13524287 AGACCCTGTCTCAAATATATAGG - Intronic
1144698903 17:17323879-17323901 AAACTCTGTCTCAAAAAAAATGG - Intronic
1145026260 17:19470006-19470028 AAACCCTGTCTCAAAAAAAAAGG - Intergenic
1145199734 17:20932700-20932722 AGACCCTGCCTCAAAAACAAAGG - Intergenic
1145768077 17:27472919-27472941 AGACCCTGTCTCAAAAAACCTGG - Intronic
1145942685 17:28751218-28751240 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1145965795 17:28916201-28916223 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1146090673 17:29874279-29874301 ACACTCTGTCTCAAAAAAATGGG + Intronic
1146228705 17:31090051-31090073 AGACCCTGTCTCAAAACAAACGG - Intergenic
1146316578 17:31812071-31812093 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1146375727 17:32292976-32292998 AGATCCTGTCTCAAAAAAAAGGG + Intronic
1146904605 17:36609933-36609955 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1146977021 17:37122119-37122141 GAACCATGTCTCAAAAAAAAGGG + Intronic
1147182571 17:38695904-38695926 AAACTCCGTCTAAAAAAAAGAGG + Intergenic
1147246271 17:39123197-39123219 AAACTCCGTCTCAAAAAAAGAGG - Intronic
1147251479 17:39155029-39155051 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1147362294 17:39938684-39938706 AGACCCTCTCTCAAAAAAAAAGG + Intergenic
1147375584 17:40020770-40020792 AAACCGTGTCTCAGAAAAACAGG + Intronic
1147501837 17:40972891-40972913 AACCCCTTTCTCAGAAAGACAGG - Intergenic
1147642527 17:42012803-42012825 AAACCCTGTCTCAAAAAAAAGGG - Intronic
1147705809 17:42423911-42423933 ACACCCTGTCTCAGAAAGGGGGG - Intergenic
1147789118 17:43002080-43002102 AGACTGTGTCTCAAAAAGTGGGG + Intronic
1147872310 17:43596200-43596222 AAACCCTGTCTCAAAAAAAAAGG - Intergenic
1147876308 17:43623241-43623263 AGACCCTGTATCAAAAAAAGGGG - Intergenic
1147973798 17:44236094-44236116 AAACTCCGTCTCAAAAAGAAAGG - Intergenic
1148004425 17:44414315-44414337 AAACCCTGTCTCCAAAAAAGGGG - Intronic
1148099800 17:45082115-45082137 AGACTCTGTCTCAAAAAGAAAGG - Intronic
1148273795 17:46284877-46284899 AGACCCTGTCTCAAAACAATGGG - Intronic
1148354440 17:46966291-46966313 AGACCCTGTCTCAAAAAAAGTGG - Intronic
1148390956 17:47272403-47272425 AGACTCTGTCTCAAAAAAAAGGG - Intronic
1148497759 17:48064057-48064079 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1148812909 17:50305844-50305866 AAACCCTGTCTCTACCAGACAGG - Intergenic
1149069379 17:52521422-52521444 AGACCCTGTCTCAAAAAGGAAGG - Intergenic
1149475453 17:56957235-56957257 AGACCCTGTCTCAAAAAATAAGG + Intronic
1149480411 17:56998942-56998964 AAACCCTGTTTCTTAAAAAGGGG + Intronic
1149530364 17:57390243-57390265 AGACCCTGTCTCAAAAAACTTGG + Intronic
1149692588 17:58590329-58590351 AGACCCTGTCTTAAAAAGGAGGG + Intronic
1149802256 17:59580778-59580800 AGACCCTGTTTCAAAAGAAGGGG + Intronic
1149844235 17:59994711-59994733 AGACCCTGTTTCAAAAGAAGGGG - Intergenic
1149871503 17:60186041-60186063 AGACCCTGTCTCAAAAAAAAGGG + Intronic
1149929748 17:60739609-60739631 AAACTCTGTCTGAAAAAAAAAGG + Intronic
1150036342 17:61803257-61803279 AAACCCTGTCTCTACAAAAAAGG - Intronic
1150109527 17:62486164-62486186 AGACCCCGTCTCAAAAAAAGAGG - Intronic
1150297844 17:64023420-64023442 AGACTCTGTCTCAAAAAGAAAGG - Intergenic
1150409261 17:64929703-64929725 AGACCCTGTCTCAAAACAATGGG + Intergenic
1150718157 17:67589956-67589978 AGACTCTGTCTCAAAAGGAAAGG + Intronic
1150744640 17:67806658-67806680 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1150761479 17:67966043-67966065 AGACCCTGTCTCAAAAAAGTGGG + Intronic
1150792630 17:68210937-68210959 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1150846700 17:68665965-68665987 AGATCCTGTCTCAGAAAAAGCGG + Intergenic
1150999834 17:70362415-70362437 AAACTCCGTCTCAAAAAAATAGG - Intergenic
1151639708 17:75382252-75382274 AGACCTTGTCTCAAAAAAAAAGG + Intronic
1151695995 17:75717863-75717885 AGACCCTGTCTCAAAAAAGAGGG + Intergenic
1151787268 17:76281170-76281192 AGACCCTGTCTCAAAAACAATGG + Intronic
1151833010 17:76566823-76566845 AGACCCTGTCTCAAAAAAGAGGG + Intronic
1151836171 17:76584487-76584509 AGACCCTGTCTCAAAAGAAAAGG - Intronic
1152083970 17:78205944-78205966 AGACCCTGTGTCAAGGAGAGTGG + Exonic
1152181484 17:78824532-78824554 AGGCCCTGTCTCAAAAAGAATGG + Intronic
1152182195 17:78829750-78829772 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1152452750 17:80392987-80393009 AGATCCTGTCTCAAAAAAAAAGG - Intronic
1152478136 17:80531894-80531916 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1152662407 17:81548727-81548749 AAATTCTCTCTCAAAAAAAGAGG + Intronic
1152668734 17:81588367-81588389 AGACCCTGTCTCAAGGATAGGGG - Intronic
1153198230 18:2624171-2624193 AAACTCTGGGTCAAACAGAGTGG + Intergenic
1153538418 18:6128697-6128719 AAACTCTGTCCCAAAAAGTCAGG + Intronic
1153749011 18:8210299-8210321 AGACTCTGCCTCAAAAAAAGGGG + Intronic
1153804728 18:8702368-8702390 AAACCCTGTCTCAAAAAAATGGG - Intergenic
1153876961 18:9382511-9382533 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1153972952 18:10242972-10242994 AGACCCTGTCTCAGAAAAAGTGG + Intergenic
1154004337 18:10513914-10513936 AAACTCTGTCTCAAACAAAAAGG + Intergenic
1154237578 18:12620134-12620156 AAACCTGTTCTCAAAAAAAGGGG + Intronic
1154256491 18:12785129-12785151 AAACTCCGTCTCAAAAAAAAAGG - Intergenic
1154967398 18:21373344-21373366 AAACTCTGTCTCGAAAAAAAAGG - Intronic
1155008493 18:21751190-21751212 AGACCCAGTCTCAAACAGAGGGG + Intronic
1155147192 18:23093917-23093939 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1155876797 18:31099876-31099898 AAATCCTGTCTCAAAAAGGGGGG - Intronic
1156187175 18:34676823-34676845 AGACCTTGTCTCAAAGAGAGAGG + Intronic
1156359003 18:36367522-36367544 AAACACAGACTCAAAAGGAGTGG + Intronic
1156390467 18:36645416-36645438 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1157175855 18:45451264-45451286 AAAGCCTGTCCCTAAGAGAGGGG + Intronic
1157247587 18:46068305-46068327 AGAATCTGTCTCAAAAAAAGAGG - Intronic
1157715766 18:49885946-49885968 AGACCTTGTCTCAAAAAAAAGGG - Intronic
1157771652 18:50352962-50352984 AGACCCTGCCTCAAAAAAAAAGG + Intergenic
1158157221 18:54439688-54439710 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1158302788 18:56070957-56070979 AAACCATTTATCAAAAAAAGAGG + Intergenic
1158936187 18:62366856-62366878 AGACTCCGTCTCAAAAAAAGTGG - Intronic
1159402858 18:67959779-67959801 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1159418370 18:68183112-68183134 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1159680571 18:71346310-71346332 AAACTCTGTCTCAAAAAAAGTGG - Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160070030 18:75620563-75620585 AAACCCTGACACATAAAGAAAGG + Intergenic
1160186906 18:76682844-76682866 AGATCCTGTCTCAAAAAAATGGG - Intergenic
1160244753 18:77148223-77148245 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1160548236 18:79676223-79676245 AGACCCTGTCTTAAAAAAAATGG - Intergenic
1160850239 19:1187605-1187627 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1160878224 19:1307752-1307774 AGACCCTGTCTCATAAAGAAGGG - Intergenic
1160925792 19:1544849-1544871 AGACCCTGTCTCAGAAAGAAAGG - Intergenic
1160926074 19:1546486-1546508 AAACTCTGTCTCCAAAAAAAAGG - Intergenic
1161177786 19:2857830-2857852 AGACCCTGTCTCAAAAAAAAAGG + Exonic
1161200190 19:3010353-3010375 AAACTCCGTCTCAAAAAAAAAGG + Intronic
1161246611 19:3256053-3256075 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1161360060 19:3843459-3843481 AGACTCTGTCTCAAAAAAATTGG + Intronic
1161524576 19:4745749-4745771 AGACTCTGTCTCAAAAAAAGGGG - Intergenic
1161536444 19:4821942-4821964 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1161615957 19:5270298-5270320 AGACCCTGTCTCTAAAAGGGGGG - Intronic
1161637357 19:5397255-5397277 AGACCCTGTCTCAAAAAAGAAGG - Intergenic
1161757043 19:6141741-6141763 AGACCCTGTCTCAAAACAAAAGG - Intronic
1161805989 19:6443243-6443265 AGACCCTGTCTCAAAAAAGTGGG - Intronic
1161828661 19:6586784-6586806 AAACCCTGTCTCAAAAAAAAGGG + Intronic
1161872064 19:6877801-6877823 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1161905194 19:7151283-7151305 AGACCCTGTCTCAAAAAGGAAGG - Intronic
1161936349 19:7374666-7374688 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1162016091 19:7847281-7847303 AAACTCCGTCTCAAAAAAAAGGG + Intronic
1162078038 19:8201968-8201990 AGATCCTGTCTCAAAAAAAGAGG + Intronic
1162103798 19:8357325-8357347 AGACCCTGTCTCCAAAACAAAGG + Intronic
1162147960 19:8624840-8624862 AAACTCTATCTCAAAAAAAGGGG + Intergenic
1162311897 19:9913060-9913082 GGACCCTGTCTCTGAAAGAGGGG - Intronic
1162317515 19:9948755-9948777 ATACCCTGTCTCAGAGAGAGAGG + Intergenic
1162356471 19:10188528-10188550 AGACTCCATCTCAAAAAGAGTGG + Intronic
1162417948 19:10549425-10549447 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1162610466 19:11746273-11746295 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1162653952 19:12114905-12114927 AGACTCCGTCTCAAAAAGGGGGG - Intronic
1162687115 19:12396638-12396660 AACCTCTGTCTCAAAAAAAAAGG + Intronic
1162691444 19:12436469-12436491 AACCTCTGTCTCAAAAAAAAAGG + Intronic
1162691733 19:12439494-12439516 CGACCCTGTCTCAAAAAAAATGG - Intronic
1162828276 19:13267788-13267810 AGACCCTGCCTCAAAAAAAAAGG - Intronic
1162865973 19:13547246-13547268 AGATCCTGTCTCAAAAGGAAAGG + Intronic
1162887275 19:13704988-13705010 AGGCCCTGTCTCAAAAAGGAAGG + Intergenic
1163009355 19:14415307-14415329 AGACCTTGTCTCAAAGAGGGGGG - Intronic
1163106683 19:15127247-15127269 AGACCCTGTCTCTAAAAAAAAGG + Intergenic
1163420472 19:17211279-17211301 AGACCCTGTCTCAGAAATAAAGG - Intronic
1163466836 19:17472827-17472849 ACACCCTGTCTCAAAAAAAAGGG - Intronic
1163585817 19:18162881-18162903 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1163771754 19:19195322-19195344 AGATTCTGTCTCAAGAAGAGAGG - Intronic
1163811279 19:19433782-19433804 AGACCTTGTCTCAAAAAAAGGGG - Intronic
1163902034 19:20111239-20111261 AGACCCTATCTCAAAAATAAAGG - Intronic
1163926193 19:20346035-20346057 AAACCCTATCTCAAAAATAAAGG + Intergenic
1164266368 19:23622528-23622550 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1164585787 19:29474972-29474994 ACACCCTGTCTCAATAAAAGTGG + Intergenic
1164602602 19:29572951-29572973 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1164609333 19:29621511-29621533 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1164654618 19:29911108-29911130 AGACCCTGTCTGAAAAAAAAAGG - Intergenic
1164715287 19:30386384-30386406 AGACCCTATCTCAAAAAAGGAGG - Intronic
1164817449 19:31215859-31215881 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1165024165 19:32947498-32947520 AAACCCCATCTCAAAAAAAAAGG - Intronic
1165024348 19:32948733-32948755 AGACCCTGTCTCAAAAAAAAGGG - Intronic
1165057203 19:33185284-33185306 AGACCCTGTCTCTAAAAGTGGGG - Intronic
1165203173 19:34161581-34161603 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1165226881 19:34361099-34361121 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1165287206 19:34852192-34852214 AAACTCCGTCTCAAAAAAAAAGG - Intergenic
1165308468 19:35016582-35016604 AAACTCTGTCTCAAAAAAACAGG + Intronic
1165310890 19:35029051-35029073 AAACTCCGTCTCAAAAAAAAAGG - Intergenic
1165498106 19:36166058-36166080 AGACCCTGTCTCAAAAAGGAAGG - Intergenic
1165556383 19:36636192-36636214 AAACTCTGTCTCAAAAAGTAAGG - Intergenic
1165666794 19:37637498-37637520 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1165691679 19:37868564-37868586 AGACCCTGTCTCAAAAAATGGGG + Intergenic
1165737195 19:38184185-38184207 AAACTCCGTCTCAAAAAAAAAGG - Intronic
1165828371 19:38718524-38718546 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1166061677 19:40329494-40329516 AAACCCAGTCTCAAAAACAGGGG + Intronic
1166063483 19:40342308-40342330 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1166075991 19:40414130-40414152 AGACCTTGTCTCAAAAAAAAGGG - Intergenic
1166086331 19:40477845-40477867 AAACTCCGTCTCAAAAAAAAAGG - Intronic
1166539214 19:43594531-43594553 AGAACCTGTCTCAAAAAAAAAGG + Intronic
1166620690 19:44297470-44297492 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1166728131 19:45041242-45041264 AAAGACTGTCTCAAAAAAAAAGG + Intronic
1167005213 19:46771794-46771816 AGACCCTGTCTCAAAAGAACAGG + Intronic
1167086233 19:47311571-47311593 AAACTCTGTCTCAAAATAAAAGG - Intronic
1167417860 19:49386673-49386695 AGAACCTGTCTCAGAAAGAGAGG + Intergenic
1167429161 19:49444382-49444404 AGACCCTGTCTCAAAAAGGAAGG - Intergenic
1167457476 19:49604860-49604882 AGACCCTGTCTCAGAAAAAACGG - Intronic
1167646136 19:50706147-50706169 AGACCCTGTCTCAAAAAAAAGGG + Intronic
1167847477 19:52176457-52176479 AGACCCTGTCTAAAAAAGAAAGG - Intergenic
1167867293 19:52338662-52338684 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1168030568 19:53676431-53676453 AAGCTCTGTCTCAAAAAGACTGG - Intergenic
1168042642 19:53770478-53770500 AGACCCTGTCTCAAAAAGAAAGG + Intergenic
1168048848 19:53813694-53813716 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1168272985 19:55259993-55260015 AGAACCTGTCTCAAAAACAAAGG + Intergenic
1168397833 19:56064028-56064050 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1168434741 19:56308042-56308064 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1168497431 19:56865245-56865267 AGACCCTGTCTCAAAAAAACCGG - Intergenic
1168501483 19:56896992-56897014 AGACTCTGTCTCAAAAAAAGAGG + Intergenic
1168668051 19:58219159-58219181 AGACCTTGTCTCAAAAAAAGAGG + Intergenic
1202695521 1_KI270712v1_random:121715-121737 AGACACTGTCTCAAAAAAAAAGG - Intergenic
925103496 2:1269509-1269531 AGACCCTGTCTCAAAAAAAAAGG + Intronic
925160908 2:1682928-1682950 AAACTCTGTCTCAAAAAAAAGGG + Intronic
925698606 2:6610093-6610115 AAACGCTGTCCCAAAAAAAAAGG + Intergenic
925923290 2:8652523-8652545 AGACCCTGTCTCAAAAATTAAGG + Intergenic
926006222 2:9375271-9375293 AGACCTTGTCTCAAAAAAAAAGG + Intronic
926245460 2:11119822-11119844 AGGCCCTGTCTCAAAAAAAAAGG + Intergenic
926342464 2:11915166-11915188 AGACCCTGTCTCAAATAAATAGG - Intergenic
926609086 2:14927401-14927423 AAACGTTGTCTTAAAAAGAAAGG - Intergenic
926704572 2:15827665-15827687 AGATCCTGTCTCAAAAAAAAAGG - Intergenic
927014086 2:18938446-18938468 AAACAGTGTCTCAAAAAGAGAGG + Intergenic
927052350 2:19342840-19342862 AAACTCCATCTCAAAAAAAGAGG + Intergenic
927411694 2:22832954-22832976 AGACTCTGTCTCAAAAAGAGAGG + Intergenic
927588528 2:24332231-24332253 AAACTCCGTCTCAAAAAAAAAGG + Intronic
927799652 2:26086275-26086297 AAACTCTGTCTCATAAAAAATGG + Intronic
927802976 2:26118321-26118343 AAACCCGGTCTCAAAAAAAAGGG - Intronic
927867812 2:26603038-26603060 AGACCCTGTCTCTAAAAAACGGG + Intronic
927977962 2:27354271-27354293 AGATCTTGTCTCAAAAAAAGTGG + Intronic
928035061 2:27815215-27815237 AGACCCTGTCTCAAAAAGAGGGG - Intronic
928068468 2:28190675-28190697 AAACTCTGTCTCAAAAAACAAGG + Intronic
928088859 2:28361932-28361954 AGACCATGTCTCTAAGAGAGGGG + Intergenic
928110067 2:28499873-28499895 AGACTCTGTCTCAAAAAAAAAGG + Intronic
928231021 2:29499206-29499228 AGACCCTGTCTCAAAAAAAAAGG - Intronic
928510285 2:31996532-31996554 ACACCCTATCTCAAAAAAAAAGG + Intronic
928893049 2:36228038-36228060 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
929162833 2:38850290-38850312 AAACCTTGTCTCAAAAAAAAAGG - Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929324198 2:40587218-40587240 AGACCATGTCTCAAAAAAAAAGG - Intronic
929505174 2:42522727-42522749 AGACCCTGTCTCAGAAAGATGGG + Intronic
929772884 2:44907415-44907437 AAACTCCATCTCAAAAAGAAAGG - Intergenic
929793620 2:45041543-45041565 AGACCCTGTCCCAGAAAAAGAGG - Intergenic
930125108 2:47789830-47789852 AGACTCTGTCTCAAAAAAAAAGG - Intronic
930587048 2:53279380-53279402 AAACTCTGTCTCAAAAAAAGAGG + Intergenic
930599496 2:53426525-53426547 AAACTCCGTCTCAAAAAAAAAGG + Intergenic
930846729 2:55913998-55914020 AGACTCTGTCTCAAAAAAAAAGG + Intronic
931149831 2:59560659-59560681 AGACTCCGTCTCAAAAAAAGAGG + Intergenic
931621983 2:64219778-64219800 AACCCCTCACTCCAAAAGAGGGG - Intergenic
931710723 2:64987966-64987988 AGACCTTGTCCCAGAAAGAGAGG + Intergenic
931914770 2:66942090-66942112 AAAACATTTCTCAAAAAGAAGGG - Intergenic
932170338 2:69549455-69549477 AAACCATGTCAGAGAAAGAGGGG - Intronic
932198901 2:69808669-69808691 AGACCCTGTCTCAAAAAAAAAGG - Intronic
932227228 2:70051963-70051985 AGACCCTGTCTCCAAAAAAAAGG + Intergenic
932280247 2:70485246-70485268 AGAGTCTGTCTCAAAAAGAAAGG - Intronic
932389530 2:71373830-71373852 AGACCTTGTCTCAAAAAGAGGGG - Intronic
932556953 2:72832932-72832954 AGACATTGTCTCAAAAAGAATGG + Intergenic
932590698 2:73065109-73065131 AGACCCTGTCTCAGAAAGAAGGG - Intronic
932622737 2:73275187-73275209 AAACTCTGTCTTAAAAAAAAGGG - Intronic
932738605 2:74274291-74274313 AGACTCTGTCTCAAAAAAACGGG + Intronic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
933681699 2:85107492-85107514 AGATCCTGTCTCTAAAAGAAAGG - Intergenic
933740366 2:85529252-85529274 AGACCCTGTTTCAAAAAAAAAGG - Intergenic
933877889 2:86637233-86637255 AGACCCCATCTCAAAAAGAAGGG + Intronic
934046392 2:88176083-88176105 AGACCCTGTCTCAAAAAAAAAGG + Intronic
934119530 2:88826460-88826482 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG + Intronic
934788788 2:97038072-97038094 AATACCTGTCACAAAAAGAGAGG + Intergenic
935030789 2:99320015-99320037 AGACCCTGTCTCAAAAAGAAAGG - Intronic
935037708 2:99395341-99395363 AGACCCTGTCTCAAAGGGAAAGG - Intronic
935272302 2:101445400-101445422 AGACCCTGTCTCAAAAAAAAAGG - Intronic
935274234 2:101462418-101462440 ACACTCTGCCTCAAAAAAAGGGG + Intronic
935503639 2:103871880-103871902 AAACTCTCCCTCAAAAGGAGTGG - Intergenic
935536632 2:104301769-104301791 AAAACCTGTATCAGAAACAGTGG - Intergenic
935627426 2:105183049-105183071 AGACCCTTTCTCAAAAAAAAGGG - Intergenic
936066685 2:109337735-109337757 AAACCCTGTCTCAAAAAAAAAGG - Intronic
936240715 2:110786495-110786517 AAATCCTGTCTCAGAAATACCGG + Intronic
936615744 2:114045903-114045925 AGACCCTGTCTCAAAAAATTAGG - Intergenic
937018048 2:118624286-118624308 AAACCCTATTTCACAAAGATAGG - Intergenic
937131748 2:119518974-119518996 AAACTCCGTCTCAAAAAAAAAGG - Intronic
937377025 2:121344339-121344361 AAACTCTGTCTCAAAAAAAAAGG - Intronic
937687406 2:124713385-124713407 AGACTCTATCTCAAAAAAAGAGG - Intronic
938134025 2:128739078-128739100 GAATACAGTCTCAAAAAGAGGGG + Intergenic
938712533 2:133988049-133988071 AATCCCTGCCTCATAAAGAATGG - Intergenic
938726890 2:134116794-134116816 AGAATCTGTCTCAAAAAAAGAGG + Intergenic
938846946 2:135219879-135219901 ATACCTTGTCTCAAAAAAAAAGG - Intronic
938848949 2:135240586-135240608 AGACCCTGTCTCAAAAAGGAAGG - Intronic
939796414 2:146650338-146650360 AAGCACTGTCCAAAAAAGAGAGG - Intergenic
939917134 2:148060298-148060320 AGACCCTGTCTCAAAGAAAAAGG + Intronic
939922901 2:148139213-148139235 AAACTCTGTTTCAAAAAAAAAGG - Intronic
940012715 2:149071939-149071961 AGACTCTGTCTCAAAAAAAAAGG - Intronic
940183450 2:150958724-150958746 AAGCCCTGTTACAAAAAGTGGGG - Intergenic
940222569 2:151368502-151368524 AAACGCTGTCTCAGAATCAGTGG - Intronic
940327525 2:152441526-152441548 AGACCCTGTCTTAAAAATGGGGG + Intronic
940380981 2:153014429-153014451 AGAACCTGTCTCAAAAAAAAGGG + Intergenic
940519865 2:154731212-154731234 ACACCCTGTCTCACATAGAAGGG - Intronic
940595500 2:155787227-155787249 AGACCGTGTCTCAAAAAAAGAGG - Intergenic
940753087 2:157649713-157649735 AAATGCTGTCTAAAAAAGAAAGG - Intergenic
941800664 2:169656278-169656300 AGACCCTGTCTCAAAAAAAGAGG + Intronic
941804913 2:169702244-169702266 AGACCTTGTCTCAAAAAAGGAGG - Intronic
941950325 2:171149193-171149215 AGACCCTGTCTCTAAAAAAAAGG + Intronic
942298706 2:174541611-174541633 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
942741749 2:179188632-179188654 AGATCCTGTCTCAAAAAAAGGGG + Intronic
942820098 2:180103493-180103515 AAATTCTGTCTCAAAAAAAAGGG - Intergenic
942909069 2:181219856-181219878 AGACCCTGTCTAGAAAAGAAAGG + Intergenic
943002147 2:182341764-182341786 AGACCCTATCTCAAAAAAAGAGG - Intronic
943140923 2:183980464-183980486 AGACTCTGTCTCAAAAAAACAGG - Intergenic
943357886 2:186881300-186881322 AAACTCTTTCTCAAAAATAAAGG - Intergenic
943469267 2:188273410-188273432 AGACACTGTCTCAAAAAAAAAGG + Intergenic
943589293 2:189778383-189778405 AAACTCCGTCTCAAAAAAAAAGG + Intronic
943641760 2:190367556-190367578 AGACTCTGTCTCAAAAAAAAGGG - Intronic
943745680 2:191460646-191460668 AGACCCTGCCTGACAAAGAGGGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
944180444 2:196886706-196886728 AGACTCTGTCTCAAAAAAAAAGG - Intronic
944450452 2:199836752-199836774 AAACCCTGTTTCAAAAAAAAAGG + Intronic
944695787 2:202199280-202199302 AGACTCTGTCTCAAAAAAAGGGG - Intergenic
944752187 2:202721641-202721663 AGACCCTGTCTCAAAAAAAAAGG - Intronic
944769652 2:202900770-202900792 AAACACTCTCACAAAAAAAGAGG + Intronic
944774679 2:202951054-202951076 AAACCTTGTCTCAAAAAAAAAGG - Intronic
944812770 2:203344371-203344393 AGACCCTGTCTCAAAAAAAAAGG - Intronic
945111705 2:206366340-206366362 AGACCCTGTCTCAAAAAGGATGG - Intergenic
945257049 2:207811535-207811557 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
945282024 2:208044900-208044922 AGACTCTGTCTCAAAAAAAAGGG - Intergenic
945509907 2:210687890-210687912 AAACTCTGTCTCTCAAAGGGAGG + Intergenic
945908092 2:215616352-215616374 AGACCCTGTCTCTAAAAAAGGGG + Intergenic
946601178 2:221362024-221362046 AGACTCCGTCTCAAAAAAAGGGG - Intergenic
946712492 2:222520761-222520783 AGACCCTGTCTCAAAAAAAAAGG - Intronic
946865015 2:224034995-224035017 AATCCCTGACTCTAAAGGAGTGG - Intronic
946866323 2:224044224-224044246 ACACTCTGTCTCAAAAAGAAAGG - Intergenic
946880511 2:224172408-224172430 AGACCCTGACTCAAAAAAAAAGG - Intergenic
946929831 2:224660572-224660594 AGACCCTGTCTCAAAAAAGAAGG - Intergenic
946936307 2:224724708-224724730 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
947028441 2:225765021-225765043 ACACTCTATCTCAAGAAGAGAGG - Intergenic
947164731 2:227250300-227250322 AGACTCTGTCTCAAAAAAATAGG + Intronic
947578871 2:231298922-231298944 AGACCCCATCTCAAAAAAAGTGG + Intronic
947761668 2:232607742-232607764 AGACCCTATCTCAAAAAAAAAGG + Intronic
948061612 2:235046560-235046582 AAACCCTGTCTTGAAAATAAAGG + Intronic
948247151 2:236496289-236496311 AAAGCCTATCTCAGAAAGAAAGG + Intronic
948506187 2:238428297-238428319 AAACTCCGTCTCAAAAAAAAAGG - Intronic
948978304 2:241478288-241478310 AGACCCTGTCTCAGAAAAAAAGG + Intronic
949007285 2:241656821-241656843 AGACTCCGTCTCAAAAAGAGGGG - Intronic
949020181 2:241736520-241736542 AAAACCTGTATGAAAAACAGAGG - Intronic
949051092 2:241897741-241897763 AGACCCTGTCTCAAAAACAAGGG - Intronic
1168755276 20:312399-312421 AGACTCTGTCTCAAAAAGGAAGG - Intergenic
1169036580 20:2457768-2457790 AGACTCTGTCTCAAAACAAGGGG + Intergenic
1169062241 20:2669588-2669610 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1169206187 20:3741621-3741643 AGACCCTGTCTCAAATAAAAAGG + Intronic
1169226500 20:3860235-3860257 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1169260139 20:4132048-4132070 ATACCCTGTCTCAGAAAAAAAGG - Intronic
1169398020 20:5252807-5252829 AGCCCCTGTCTCTAAAAGAAAGG - Intergenic
1170292069 20:14781933-14781955 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1170405441 20:16030450-16030472 AAACCTTGACTGAGAAAGAGAGG + Intronic
1170764484 20:19278444-19278466 AAACCCAGCCTGAAACAGAGGGG + Intronic
1170951413 20:20939682-20939704 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1170977196 20:21176004-21176026 AGACCCTGTCTGAAAAAAAATGG + Intronic
1170992416 20:21315499-21315521 AAACCCTGTCTCAAAAAAAAGGG - Intronic
1171212219 20:23325783-23325805 AGACTCTGTCTCAGAAAAAGGGG + Intergenic
1171416300 20:24982858-24982880 ACATCCTGTCTCCAAAGGAGGGG - Intronic
1171493245 20:25537094-25537116 AGACCCTGTTTCAAAAACAAAGG - Intronic
1171754982 20:29098199-29098221 AAACCATGTGTCAAGAAGGGGGG - Intergenic
1171754993 20:29098311-29098333 AAACCATGTGTCAAGAAGGGGGG - Intergenic
1171755004 20:29098423-29098445 AAACCATGTGTCAAGAAGGGGGG - Intergenic
1171755014 20:29098535-29098557 AAGCCATGTGTCAAGAAGAGGGG - Intergenic
1172088149 20:32405910-32405932 AAACCCCATCTCAAAAAAAAAGG - Intronic
1172227720 20:33316386-33316408 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
1172313305 20:33934320-33934342 AAACTCTGTCCCAAAAAGAAAGG + Intergenic
1172324008 20:34020049-34020071 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1172369770 20:34379905-34379927 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1172403613 20:34671270-34671292 AAACTCCGTCTCAAAAAAAAAGG - Intronic
1172488727 20:35316943-35316965 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1172579454 20:36035470-36035492 AAACTCTCTCTCAAAAAAAAGGG + Intergenic
1172730685 20:37084772-37084794 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1172759718 20:37313694-37313716 AGACCTTGTCTTAAAAAGAATGG + Intronic
1172874107 20:38153824-38153846 AGACTCTGTCTCCAAAAAAGGGG - Intronic
1172923294 20:38506299-38506321 AAACCCTGTCAAAAAAAAAAAGG - Intronic
1172946749 20:38695274-38695296 AGACCCTGTCTCAAAAATAAAGG - Intergenic
1173015116 20:39218459-39218481 AGACCCTGTCTCAAAAAAGGAGG - Intergenic
1173526235 20:43735031-43735053 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1173802502 20:45903211-45903233 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1173876929 20:46378999-46379021 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1174241752 20:49141757-49141779 AGACTCTGTCTCAAAAAAAGAGG + Intronic
1174261976 20:49302803-49302825 AGACCGTGTCTCAAAAAAAAGGG + Intergenic
1174305229 20:49610294-49610316 AGACCCTTTCTCAAAAAGGCTGG + Intergenic
1174312116 20:49665401-49665423 AGACCCTGTCTCTCAAAAAGGGG + Intronic
1174335331 20:49855798-49855820 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1175365441 20:58451715-58451737 AGACCCTGTCTCAAAACAAAAGG - Intergenic
1175371201 20:58494345-58494367 AAACCCTGACTCAAGAAAAAAGG - Intronic
1175483538 20:59328371-59328393 AAACTCAGACTCAAAAATAGGGG - Intergenic
1175512306 20:59538113-59538135 ATATCCTGTATCAAAAAAAGTGG + Intergenic
1175807331 20:61837181-61837203 AGACCCTGTCTCAAAAAAAACGG + Intronic
1176164682 20:63666543-63666565 AGACCCTGTTTCAAAAAAAAGGG - Intronic
1176409605 21:6441310-6441332 AGACCTTGTCTCAAAAAAAGGGG - Intergenic
1176514937 21:7777024-7777046 AGACTCTATCTCAAAAAGAAAGG - Intergenic
1176721945 21:10400711-10400733 AAACTCCGTCTCAAAAAAAAAGG + Intergenic
1177483155 21:21720297-21720319 AAACATTGTCGAAAAAAGAGAGG - Intergenic
1177624686 21:23645400-23645422 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1177733481 21:25059305-25059327 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1178034898 21:28569702-28569724 AGACTCCGTCTCAAAAAGAGTGG - Intergenic
1178076395 21:29016966-29016988 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1178603001 21:34011251-34011273 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1178648992 21:34407083-34407105 AGACTCTATCTCAAAAAGAAAGG - Intronic
1178800924 21:35794869-35794891 AGATCCTGTCTCAAAAAAAAAGG - Intronic
1178871114 21:36377104-36377126 AAACTCCGTCTCAAAAAAAAAGG + Intronic
1178999459 21:37443157-37443179 AGACCCTGTCTCTAAAAGAAAGG - Intronic
1179105034 21:38391884-38391906 AAACACTGTAACAAAAAAAGAGG + Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179216875 21:39374948-39374970 AGACCCTGTCAAAAAAAAAGGGG - Intergenic
1179442625 21:41405998-41406020 AAACTCCGTCTCAAAAAGGCCGG - Intronic
1179672351 21:42958597-42958619 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1179685098 21:43049632-43049654 AGACCTTGTCTCAAAAAAAGGGG - Intergenic
1179841909 21:44081867-44081889 AGACCCTGTCTCAAAGAAAGGGG + Intronic
1180216931 21:46330125-46330147 AGACCCTATCTCAAAAAAAAGGG - Intronic
1180303136 22:11053488-11053510 AAACTCCGTCTCAAAAAAAAAGG + Intergenic
1180355242 22:11834143-11834165 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1180577760 22:16795955-16795977 AAACTCAGTCTCAAAAAAAAAGG + Intronic
1180628688 22:17211915-17211937 AGACTCCGTCTCAAAAAAAGAGG + Intronic
1180894693 22:19321308-19321330 TAAGACTGTCTCAAAAAAAGGGG + Intergenic
1181114574 22:20623208-20623230 AGACCCTGTCTCAAAAGAATAGG - Intergenic
1181157909 22:20936148-20936170 AGACCCTATCTCAAAAAAAGGGG + Intronic
1181275297 22:21684195-21684217 AGACCCTGTCTCAAAAGGCTGGG + Intronic
1181337470 22:22150075-22150097 AAACCCTTACTCAAAAAGAGAGG - Intergenic
1181569647 22:23761375-23761397 AAACTCTGTCAAAAAAAGAAAGG + Intergenic
1181919603 22:26310525-26310547 AAACTCTGTCAAAAAAAAAGAGG + Intronic
1182188015 22:28427642-28427664 AAACTCCGTCTCAAAAAAAGAGG + Intronic
1182391039 22:29996734-29996756 AGACCCTGTCTCAAAAAAAGGGG - Intronic
1182588289 22:31359423-31359445 CAACTCTGTCTCAAAAAAAAAGG - Intergenic
1182591004 22:31379875-31379897 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1182626625 22:31651737-31651759 AAACTCCGTCTCAAAAAAAAAGG + Intronic
1182723583 22:32424788-32424810 AAACTCCGTCTCAAAAAAAAAGG - Intronic
1182742469 22:32578254-32578276 AGACCCTGTCAGAAAGAGAGAGG - Intronic
1182858823 22:33541168-33541190 AGACCCTGTCTCAAAAAAAGTGG + Intronic
1182901370 22:33901036-33901058 AAACTCTGTCTCAGAAAAAAAGG + Intronic
1183082628 22:35466428-35466450 AGACCCTGTCTCAGAAAAAAAGG - Intergenic
1183689466 22:39380411-39380433 AGACCCTGTCTCTAAAAAAAAGG - Intronic
1183714753 22:39527134-39527156 AGACCCTGTCTCAAAAAAAGAGG - Intergenic
1183884867 22:40871017-40871039 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1184029380 22:41882795-41882817 AAACTCCATCTCAAAAAGAAAGG + Intronic
1184113122 22:42406782-42406804 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1184197050 22:42936899-42936921 AGACTCTGCCTCAAAAAAAGGGG + Intronic
1184317569 22:43708385-43708407 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1184578439 22:45394311-45394333 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1185314373 22:50172439-50172461 AGACTCTGTCTCAAAAAAAAAGG - Intronic
949162945 3:902964-902986 AAACCCAGACTGAAAATGAGAGG + Intergenic
949744098 3:7268444-7268466 AGACCCTGTCTTAAAAAAAAAGG + Intronic
950068038 3:10129197-10129219 GAACTCTGTCTCAAAAAAAAAGG - Intergenic
950751194 3:15129449-15129471 AGACCCTGTCTCAAACAAACAGG - Intergenic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
950759581 3:15209017-15209039 AAACTCCGTCTCAAAAAAAAAGG - Intronic
950817872 3:15726031-15726053 AAACTCTGTCTCCAAAAAAGTGG + Intronic
951009679 3:17661898-17661920 AGACCCTGTCTTAAAAAAAAAGG - Intronic
951124200 3:18964017-18964039 AAACCCTGTCTTTACAAGAAAGG - Intergenic
951168211 3:19507391-19507413 AAGCCCTGCCTCATGAAGAGTGG + Intronic
951484328 3:23194771-23194793 AGACCCTGTCTCAAAAAAGAAGG + Intergenic
951535192 3:23734235-23734257 AGACCTTGTCTCAAAAAAATAGG + Intergenic
951894504 3:27598467-27598489 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
952441581 3:33335838-33335860 AGACCCTGTCTCAGAAGAAGCGG + Intronic
952455460 3:33467766-33467788 AAACTCCGTCTCAAAAAAAAAGG + Intergenic
952799228 3:37272525-37272547 AGACCCTGTCTCAGAAAAAAAGG + Intronic
952850495 3:37724502-37724524 AAACTCTGTCTCAAAAAAAAAGG - Intronic
952882456 3:37993408-37993430 AGACCCTGTCTCGAAAAAACTGG + Intronic
953013003 3:39046248-39046270 AGACTCTGTCTCAAAAAGAAAGG + Intergenic
953117362 3:40006377-40006399 AGACTCTGTCTCAAAAAAAAAGG + Intronic
953278782 3:41531429-41531451 AGACTCCGTCTCAAAAAGAGGGG + Intronic
953400445 3:42610010-42610032 AAACTCTGTCTCAAAAAAAAAGG - Intronic
953597385 3:44330450-44330472 AAATTCTGTCTCATAGAGAGAGG - Intronic
953705862 3:45229747-45229769 AGACTCTGTCTCAAAAAAAGAGG - Intergenic
954044909 3:47921136-47921158 AGACCCTGTCTCAAAAAAAAGGG + Intronic
954083558 3:48226430-48226452 AAACCCTGTCTCTACTAAAGTGG + Intergenic
954776954 3:53028098-53028120 AGACCCTGTCTCAAAAAGAGTGG - Intronic
954787632 3:53106055-53106077 AAACCCTGTCTCTACAAAAATGG + Intronic
954840515 3:53507606-53507628 AGACCCTGTCTCAAAAATAAAGG + Intronic
954923017 3:54208112-54208134 AAACTCCATCTCAAAAAGAAAGG - Intronic
954975659 3:54691986-54692008 AGACTCTGTCTCAAAAAAAAAGG - Intronic
955238442 3:57160160-57160182 AAACTCCGTCTCAAAAAAAGAGG + Intronic
955299549 3:57764198-57764220 AACCCCTGTTTAAGAAAGAGTGG + Intronic
955496191 3:59535215-59535237 AATACCTGTTTCAGAAAGAGAGG - Intergenic
955991316 3:64630565-64630587 AGACCCTGTCCCAAAAATACAGG + Intronic
956059030 3:65331209-65331231 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
956132108 3:66063890-66063912 AGACCTTGTCTCTAAAAGAAAGG - Intergenic
956294767 3:67700397-67700419 AGACCCCGTCTCTAAAAGAAAGG - Intergenic
956351294 3:68339801-68339823 AAACCATCTCTAAAAGAGAGGGG + Intronic
956426140 3:69137660-69137682 AGACCCTGCCTCAAAAAAAGGGG - Intergenic
956583652 3:70841389-70841411 AAACTCAGTCTCAAAAAAACAGG - Intergenic
956657185 3:71563826-71563848 CAACACTGTCTCAAAAAATGAGG + Intronic
956791567 3:72684075-72684097 AGACCCTGTCTGAAAAAAAAAGG - Intergenic
956884371 3:73544194-73544216 CAACTCTGTCTCAAAAACAAAGG + Intronic
957851179 3:85809563-85809585 AGACCCTGTCTCATAAAAAAAGG + Intronic
959542354 3:107554711-107554733 AGACCCTGTCTCAAAAGAAAAGG + Intronic
959667314 3:108936250-108936272 AGACCCTGTCTCGAAAAAAAAGG + Intronic
959958690 3:112270804-112270826 AGACTCTGTCTCAAAAAAAAAGG + Intronic
960022790 3:112974424-112974446 AGACCCTGTCTCAAAAAAGGGGG + Intronic
960982663 3:123245656-123245678 TGACCCTGTCTCAAAAAAAAAGG + Intronic
961030600 3:123600124-123600146 AGACCCTGTCTCAGAAAAAAAGG - Intergenic
961137421 3:124524963-124524985 AAGCCCAATCTAAAAAAGAGTGG - Intronic
961183525 3:124895234-124895256 AGACCCTGTCTCAAAAGAAAAGG - Intronic
961278813 3:125748991-125749013 AAACTCTGACTCAAAAAAAAAGG - Intergenic
961528565 3:127525322-127525344 AGACCCTGTCTCAAACAAAAAGG + Intergenic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
961679134 3:128587062-128587084 AAACTCTGTCTAAAAAAAAAAGG + Intergenic
961767572 3:129223402-129223424 AGATCCTGTCTCAAAAAAATGGG + Intergenic
962131232 3:132679256-132679278 AGACTCTGTCTCAAAAAAAAAGG + Intronic
962211655 3:133484262-133484284 AAAGCTTGTATCAAAAAGACAGG - Intergenic
962586051 3:136843634-136843656 AGACCCTGTTTCAAAAAGGCTGG + Intronic
962644891 3:137428440-137428462 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
962664580 3:137641391-137641413 AGACCCTGTCGCAAAAAAAAAGG - Intergenic
963140254 3:141941004-141941026 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
963302239 3:143611741-143611763 AGACCCTGTCTCAAAAATAAGGG - Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
963888465 3:150606602-150606624 CAACACTGTCTCAAAAACAATGG - Intronic
964583402 3:158266754-158266776 AAACCCTGTATCAAAAAGAGGGG - Intronic
964653775 3:159043556-159043578 AGAGACTGTCTCAAAAAAAGCGG - Intronic
965123075 3:164588659-164588681 AGACCCTCTCTCAAAAAAAGAGG + Intergenic
965141409 3:164840926-164840948 AAAACATGTCTAATAAAGAGAGG + Intergenic
965372548 3:167881650-167881672 AGACCCTGTCTCTAAAAAAAAGG + Intergenic
965771592 3:172187661-172187683 GAATCCAGTCTCCAAAAGAGGGG - Intronic
966365523 3:179182659-179182681 AGACCCTGTCTCAAAAAAAAAGG + Intronic
966435844 3:179883054-179883076 AGACCCTGTCTCTAAAAAAAAGG + Intronic
966438425 3:179916677-179916699 AGACGCTGTCTCAAAAACAAAGG - Intronic
966711025 3:182973031-182973053 AAACTCCGTCTCAAAAAAAAAGG + Intronic
966723707 3:183089602-183089624 AGACCCTGGCTCAAAAAAAAAGG + Intronic
966749200 3:183305838-183305860 AAACTCCGTCTCAAAAAAAAGGG + Intronic
966804759 3:183798361-183798383 AAACTCTGTCTCAAAAGAAAAGG - Intronic
966805708 3:183805777-183805799 AAACCCTGTCCAAAAAAAAAAGG + Intronic
966846063 3:184130801-184130823 AGACCCTGTCTCAAAAAATGGGG + Intergenic
967202198 3:187082046-187082068 AGACCCTGTCTCAAAAAGAATGG - Intergenic
967273666 3:187752134-187752156 AGACCCTGTCTCTAAAAAAACGG + Intergenic
967572588 3:191047964-191047986 AAACCATGTTTCAAAAATAGAGG - Intergenic
967936740 3:194734545-194734567 AGACTCTGTCTCAAAAAGAGAGG + Intergenic
968029982 3:195475249-195475271 AGACTCTGTCTCAAAAAAAGAGG + Intergenic
968210240 3:196842713-196842735 AAACTCCGTCTCAAAAAAAAAGG + Intergenic
968321204 3:197770551-197770573 AAGCCCTGTCTCAAAAAACAGGG - Intronic
968524671 4:1049940-1049962 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
968781117 4:2582161-2582183 AGACCTTGTCTCGAAAAGAAAGG - Intronic
969088057 4:4671151-4671173 AAACCCTGTCTCTACAAAAGAGG + Intergenic
969288711 4:6224786-6224808 AGACCCTGTCTCAAAATAATAGG + Intergenic
969536599 4:7760188-7760210 AAAGTCTGTTTCAAAAAGTGTGG - Exonic
969789840 4:9485617-9485639 AAACCCTGACTCAAAAAATAAGG - Intergenic
969977958 4:11123955-11123977 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
970010474 4:11453457-11453479 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
970596277 4:17603296-17603318 AGACTCTGTCTCAAAAAAGGAGG + Intronic
971194456 4:24458489-24458511 AGACCCTGTCTCAAAAGAAAAGG + Intergenic
971303488 4:25461216-25461238 TGACCCTGTCTCAAAAAAAAGGG + Intergenic
971629967 4:28978426-28978448 TAACCCTGTCAGAAAAAAAGTGG - Intergenic
972277288 4:37569085-37569107 AGACCCTGTCTCAAAAAAAAAGG + Intronic
972456656 4:39262263-39262285 AGACCCTGTCTCAAAACGGGGGG - Intronic
972571325 4:40312845-40312867 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
972591689 4:40493927-40493949 AGACCCTGTCTCAAAAATAAAGG + Intronic
972624149 4:40779609-40779631 ACACTCTGTCTCTAAAAAAGTGG + Intronic
972773474 4:42219921-42219943 AAACCTTGTCTCAAAAAAAAAGG - Intergenic
972834341 4:42851058-42851080 AAACCCTGTCTCTAAAAAAAAGG - Intergenic
973253892 4:48089398-48089420 AGACTCTGTCTCAAAAAAAAAGG - Intronic
973325460 4:48856396-48856418 AAACTCTGTCTCAAAAAAAAAGG - Intronic
973388078 4:49528585-49528607 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
973689916 4:53416951-53416973 AGACCCTGTCTCAAAAAAAAAGG + Intronic
973953394 4:56039634-56039656 ATACTCTGTCTCAAAAAAAGAGG + Intergenic
973957591 4:56078414-56078436 AGACTCTGTCTCAAAAAGAAAGG - Intergenic
973980562 4:56305209-56305231 AGACCCTGTCTCAGAAAAAAAGG + Intronic
974042610 4:56870459-56870481 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
974408199 4:61504000-61504022 AAACCCTGTCTTACAAAAAGGGG - Intronic
974864370 4:67562330-67562352 AAACTCCGTCTCAAAAAAAAAGG + Intronic
974931329 4:68364632-68364654 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
974939561 4:68449531-68449553 AAGCACTGTCTCTAAAAGTGTGG + Intronic
975117960 4:70700296-70700318 AGAATCTGTCTCAAAAAAAGAGG - Intergenic
975470801 4:74764503-74764525 ACACCCTTTGACAAAAAGAGGGG - Intronic
975564862 4:75743784-75743806 AGACTCTGTCTCAAAAAAAAGGG - Intronic
975708521 4:77135436-77135458 AAACACTGTCTCAAAAAAAAAGG - Intergenic
975788446 4:77920765-77920787 AGACACTGTCTCAAAAAAAAAGG - Intronic
975800395 4:78055413-78055435 AGACTCTGTCTCAAAAATAAAGG - Intergenic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
976221795 4:82762160-82762182 AGACCCTGTCTCAAAAGAAGAGG + Intronic
976228360 4:82814866-82814888 AAATCCTCTCTCAAAAGAAGTGG - Intergenic
976274836 4:83265671-83265693 AAACTGTGTCTCAAAAACAAAGG - Intronic
976380316 4:84391324-84391346 GGACCCTGTCTCAGGAAGAGTGG + Intergenic
976396811 4:84564859-84564881 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
976598616 4:86917268-86917290 AGACCCTGTCTTCAAAAAAGAGG + Intronic
976722322 4:88180741-88180763 AGACCCTGTCTCAAAATAAAAGG + Intronic
976735543 4:88305087-88305109 AGACCCTCTCTCAAAAAAAGAGG + Intergenic
977232274 4:94465969-94465991 AGACCCTGTCTCAAAAACAAAGG - Intronic
977344509 4:95800429-95800451 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
977540187 4:98308458-98308480 AGACCCTGTCTCAGAAAGAAAGG + Intronic
977622683 4:99154984-99155006 AAACACTGTCTCATAAAATGGGG + Intronic
978135167 4:105249035-105249057 AGACTCTGTCTCAAAAAATGTGG - Intronic
978135556 4:105254418-105254440 AGACCCTGTCTCAAAAACAAAGG - Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978783504 4:112582459-112582481 AGACTCTGTCTCAAAAAAAAAGG - Intronic
979318744 4:119299095-119299117 AAACCCTGTCTCAAAAAAAGGGG - Intronic
979323353 4:119350344-119350366 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
979378132 4:119973354-119973376 CAACTCTGTCTCAAAAAAATGGG + Intergenic
979467240 4:121054837-121054859 AGACCCTGTCTCAAAAAAGTTGG - Intronic
980022673 4:127728340-127728362 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
981946079 4:150345813-150345835 AGACCCTGTCTCAAAAAAAAAGG - Intronic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
982441405 4:155440588-155440610 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
982767132 4:159362063-159362085 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
983191209 4:164755468-164755490 AGACTCTGTCTCAAACAGAAAGG + Intergenic
983241182 4:165234987-165235009 AGACTCTGTCTCAAAAAAAAAGG + Intronic
983578969 4:169288701-169288723 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
983617590 4:169725154-169725176 AGACCCTGTCTCAAAAAGCAAGG + Intergenic
983685806 4:170407480-170407502 AAACCCTGTCCCAAAGTGAATGG + Intergenic
983773234 4:171575200-171575222 AAATGCTGTCTCAAAATGACAGG + Intergenic
984621906 4:181963173-181963195 AAAAGCTGTCTCAAACAGATGGG + Intergenic
984750803 4:183271994-183272016 AGACCCTGTCTCAAAAAAATGGG + Intronic
984902279 4:184596010-184596032 AGACCCTGTCTCAAAAGAAAAGG + Intergenic
986683879 5:10258981-10259003 AGACTCTGTCTCAAAAAAAATGG + Intronic
986699601 5:10393064-10393086 AAACCTTGTCTCAAAAAAAAAGG - Intronic
986879114 5:12147933-12147955 AAACCTTGTCTCAAAAAGAAAGG - Intergenic
987104981 5:14629850-14629872 ATATACTGTCTCAAAAAGGGGGG - Intergenic
987207702 5:15644464-15644486 AAACTCTGTCTCAAAAAAAATGG + Intronic
987535292 5:19179103-19179125 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988137089 5:27187694-27187716 AAACCCTGTCTCAAAAAAAAGGG + Intergenic
988174001 5:27696781-27696803 TGACACTGTCTCTAAAAGAGAGG + Intergenic
988462516 5:31453203-31453225 AGACCCTGTCTCAAAAATAAAGG - Intronic
988590675 5:32546217-32546239 ATACTCTGTCTCAAAAAAAAAGG - Intronic
988643961 5:33073345-33073367 AGACCTTGTCTCAAAAAAATTGG - Intergenic
988645926 5:33095029-33095051 AGACCCTGTCTCAGAAAAAGAGG - Intergenic
989055221 5:37360106-37360128 AGACTCTGTCTCAAAAAAAAGGG + Intronic
989570462 5:42941789-42941811 AAACTCTGTCTCAGAAATAAAGG - Intergenic
989628628 5:43458108-43458130 AGACCCTGTCTCAAAAATTAAGG - Intronic
989642015 5:43591990-43592012 AGACTCTGTCTCAAAAAAAAGGG - Intergenic
990081596 5:51922579-51922601 AAACCCTGCCTCTAAAAAAAAGG - Intergenic
990589432 5:57247673-57247695 AGACCCTGTCTCAAAAGTGGTGG + Intronic
990599264 5:57341070-57341092 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
990716528 5:58643666-58643688 AAACTCTGTCTCAAAAAAATTGG + Intronic
990729500 5:58793064-58793086 GAACCCTGTCACAAATGGAGGGG + Intronic
991240427 5:64452488-64452510 AGACCCTGTCTCAAAAGAAAAGG + Intergenic
991354906 5:65758224-65758246 AGACCCTGTCTTAAAAAAAGAGG + Intronic
991474044 5:67000737-67000759 AAACTCTGTCTAAAAAAAAAGGG + Intronic
991717955 5:69469528-69469550 AAACTCCGTCTCAAAAAAAAAGG - Intergenic
992145195 5:73839968-73839990 AACCACTGACTCAAAATGAGGGG - Intronic
992317691 5:75575188-75575210 AGACCCTGTGTCAAAAAAAACGG - Intronic
992386399 5:76288887-76288909 AGACCCTGTCTCAAAAAATAAGG - Intronic
992439491 5:76785996-76786018 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
992491128 5:77245859-77245881 AGACCCTATCTCAAAAAGTTGGG - Intronic
992691847 5:79248314-79248336 AGACTCTGTCTCAAAAAAAAGGG - Intronic
992702356 5:79353426-79353448 AAACCCTGTCTCAAGAAAGATGG - Intergenic
992734174 5:79702374-79702396 AGACCCTGTCTCAAAAAAAAGGG + Intronic
992798066 5:80271015-80271037 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
993389915 5:87306866-87306888 AGACCCTGTCTCAAAAAAAGGGG - Intronic
994164276 5:96592389-96592411 AGACTTTGTCTCAAAAAAAGGGG + Intronic
994712119 5:103278696-103278718 AAACTCTGTGGCAAAAATAGGGG + Intergenic
995114890 5:108468618-108468640 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
995137501 5:108695811-108695833 AAATCCTGTCTCAAGAGGAGGGG + Intergenic
995157332 5:108930628-108930650 AGACCCTGTCTCAAAAAGGAAGG - Intronic
995176498 5:109183753-109183775 AGACCCTGTCTCAAGAAAAGTGG + Intronic
995209500 5:109521161-109521183 GAACCATGTCTCATAAAGTGAGG + Intergenic
995231748 5:109772517-109772539 AGAACCTGTCTCAAAAAAAGTGG - Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995466365 5:112453280-112453302 AGACTCCGTCTCAAAAAAAGAGG - Intergenic
995602802 5:113816714-113816736 AGACCCTTTCTCAAAAGGAAAGG + Intergenic
995630051 5:114123125-114123147 AAACACTGCCTCAGTAAGAGTGG - Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
995938560 5:117549356-117549378 AAACTTTGTTTCAAAAAGAATGG + Intergenic
995940456 5:117576207-117576229 AAAAGCTGTCTCAATAAAAGAGG + Intergenic
995964158 5:117883763-117883785 AGACTCCGTCTCAAAAAGAAGGG + Intergenic
996402607 5:123079025-123079047 GAAACCTGTATCAAAAAGAATGG + Intergenic
996445346 5:123542635-123542657 AACACCTGTGGCAAAAAGAGGGG + Intronic
996570676 5:124929739-124929761 AGACCCTGTCTCTAAAAGAAAGG - Intergenic
997014327 5:129914117-129914139 AAACTCTGTGTCAAAAAAAAAGG - Intronic
997121184 5:131174832-131174854 AGGCCCTGTCTCAAAAAAAAAGG + Intronic
997486712 5:134237063-134237085 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
997511457 5:134457661-134457683 AGACCTGGTCTCAAAAAGGGGGG + Intergenic
997836965 5:137202452-137202474 AAACCAGGTCTCAAATGGAGTGG - Intronic
997859282 5:137401732-137401754 AGACCCTGACTCAAAAAGAAAGG + Intronic
997937018 5:138121406-138121428 ACACCCTGTCTCAAAAAAAAAGG + Intronic
998091225 5:139371070-139371092 AGACTCTGTCTCAAAAAAAAAGG + Intronic
998125738 5:139619852-139619874 AAACTCCGTCTCAAAAAAAAAGG + Intronic
998611762 5:143696597-143696619 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
998926935 5:147136923-147136945 AAACTCTGTCTCAAAAAAAATGG - Intergenic
998968640 5:147567590-147567612 AGACTCTGTCTCAAAAAAAAGGG + Intergenic
999085189 5:148881977-148881999 AAAGAATGTTTCAAAAAGAGAGG - Intergenic
999303591 5:150506118-150506140 AGACCCTCTCTCAAAAACAAAGG - Intronic
999349139 5:150850568-150850590 AGACCCTGTCTCAAAAAAGGGGG - Intronic
999360104 5:150976966-150976988 AGGCCCTGTCTCAAAAAAAGAGG + Intergenic
999464823 5:151793116-151793138 AGACCTTGTCTCAAAAAAAAAGG - Intronic
999788457 5:154913805-154913827 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1000070100 5:157732436-157732458 AGACCCTGTCTCAGAAAAAGAGG + Intronic
1000102476 5:158029689-158029711 AGACCCTGTCTCAAAAAGGAAGG - Intergenic
1000117478 5:158166959-158166981 AGACCCTGTCCCAAAAAAAGTGG - Intergenic
1000207023 5:159071549-159071571 CAATCCTGTTTCAAAAACAGGGG + Intronic
1000316934 5:160101338-160101360 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1001464675 5:171952976-171952998 GAACCTTGTCTCTAAAACAGGGG - Intronic
1001496544 5:172191780-172191802 AGACCCTGTCTTAAAAAGGAAGG + Intergenic
1001608280 5:172979647-172979669 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1001781037 5:174369441-174369463 AAAATCTGTCTCAAAAAAAGAGG - Intergenic
1001883054 5:175261609-175261631 AGACCGTGTCTCAAAAATGGGGG - Intergenic
1002030460 5:176424825-176424847 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1002130085 5:177075693-177075715 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1002519554 5:179783945-179783967 AGACCCTGTCTCCAAAAAAAAGG + Intronic
1003104332 6:3202942-3202964 AGACCCTGTCTCAAAAAAGGAGG + Intergenic
1003222709 6:4175788-4175810 AGACCCTGTCTCTAAAAAAAAGG + Intergenic
1003326684 6:5097351-5097373 AGACCCTGTCTCAAACATATAGG - Intergenic
1003727125 6:8777328-8777350 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1003812752 6:9803348-9803370 AGACCCTGTCTCAATAAAAGGGG - Intronic
1004037411 6:11936822-11936844 AGACTCTGTCTCAAAAGTAGAGG - Intergenic
1004186755 6:13427639-13427661 AGAGCCTGTCTCAAAAAAAAAGG + Intronic
1004224572 6:13773856-13773878 AGACCCTGTCTCAAAAACAAGGG + Intergenic
1004383498 6:15152233-15152255 AAACTCTGTCTCAAAAAAAAAGG + Intergenic
1004469187 6:15913726-15913748 AGACCCTGTCTCAAAAAGGAAGG + Intergenic
1004629687 6:17409360-17409382 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1004688514 6:17971429-17971451 AGACCCTGTGTCAAAAAAAAAGG - Intronic
1004732930 6:18375842-18375864 AGACCCTGTCTCAAAGAAAAAGG + Intergenic
1004761346 6:18669954-18669976 AAACAGTGTCTCCAAAATAGAGG - Intergenic
1004995075 6:21183308-21183330 GAACCCTGTCTGAAAAGCAGAGG - Intronic
1005079760 6:21945027-21945049 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1005150435 6:22742640-22742662 AAACCATGTTTCTAAAAGAAAGG - Intergenic
1005219741 6:23572878-23572900 AGACCCTGTCTCAAATATATAGG - Intergenic
1005310700 6:24556218-24556240 AGACCCTGTCTCAAAAAAAATGG - Intronic
1005382342 6:25249155-25249177 AAACCCTGTCTCTAATAGCTGGG + Intergenic
1005601840 6:27434028-27434050 AGACCCTGTCTCAAACAAAGAGG - Intergenic
1005758375 6:28945888-28945910 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1005833580 6:29690467-29690489 AAACTCTGTCTTAAAAAGGCCGG - Intergenic
1005925151 6:30438308-30438330 AGACCCTGTCTCAGAAAAAAGGG + Intergenic
1005991554 6:30905992-30906014 AGACCCTGTCCCAAAAGGAGAGG - Intergenic
1005993664 6:30919126-30919148 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1006468657 6:34212540-34212562 AAACTCCGTCTCAAAAAAAAAGG + Intergenic
1006479894 6:34283674-34283696 AAACCCTGCCTCTAAAAGGGCGG - Exonic
1006624594 6:35388408-35388430 AACCTTTTTCTCAAAAAGAGGGG + Intronic
1006624711 6:35389174-35389196 AGACCCTGTCTCAAAAAAAGCGG + Intronic
1006693709 6:35912790-35912812 GACCCCTGTCTCCAAAAGAAGGG - Intronic
1006739973 6:36301128-36301150 AGAACCTGTCTCAAAAATAGTGG - Intronic
1006760712 6:36458060-36458082 AGACCCTGTCTCAAAAAAGAAGG - Intronic
1006788711 6:36684837-36684859 GACACCTGTCTCAAAAAGAAAGG - Intronic
1006853986 6:37119996-37120018 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1006863366 6:37188515-37188537 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1006939287 6:37741338-37741360 AGACCCTATCTCAAAAAAAAGGG + Intergenic
1006975612 6:38098070-38098092 AGACCCTATCTCAAAAAGCGGGG - Intronic
1007020169 6:38511980-38512002 AAACTCCGTCTCAAAAAAAGGGG - Intronic
1007413469 6:41678582-41678604 AGACCCTGCCTCAAAAACAAGGG + Intergenic
1007469523 6:42079570-42079592 AGACCCTGTCTCAAAATAAAAGG - Exonic
1007880960 6:45166280-45166302 AGACTCTGTCTCAAAAAGCAGGG + Intronic
1008076553 6:47151960-47151982 AGACCCTGTCTCAAGACAAGAGG + Intergenic
1008559548 6:52710316-52710338 AGATCCTGTCTCAAAAAAAAGGG + Intergenic
1008657332 6:53629295-53629317 AGAACCTGTCTCAAAAAAAAAGG - Intergenic
1009440153 6:63668345-63668367 AGAGCCTGTCTCAAAAAAAAGGG - Intronic
1009490040 6:64278771-64278793 AGACCCTATCTCAGAAAGAGAGG - Intronic
1010233726 6:73557808-73557830 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1010248577 6:73684692-73684714 AGATCCTGTCTCTAAAAAAGAGG - Intergenic
1011083658 6:83515655-83515677 AGACCCTGTCTCTACAAGTGTGG - Intronic
1011130984 6:84051711-84051733 AGACCTTGTCTCAAAAAAAGGGG + Intronic
1011283671 6:85702275-85702297 AGACCCTGTTTCAAAAAGGAAGG - Intergenic
1011417453 6:87137369-87137391 AGATCCTGTCTCAAAAAAAGAGG - Intergenic
1011484816 6:87830212-87830234 AGACCCTGTCTCAAAAGAAGAGG - Intergenic
1011644784 6:89447243-89447265 AGACCCTGTCTCAAAAAAAAGGG + Intronic
1011661593 6:89599361-89599383 AGACCCTGTCTCAAAATGAGTGG + Intronic
1012227093 6:96717109-96717131 AAGCCCTGTCTGAAAAAAGGGGG - Intergenic
1012286481 6:97395897-97395919 AAACTCCGTCTCAAAAAAAAAGG - Intergenic
1012369335 6:98483722-98483744 AAACAAGGTCTCAAAAAGTGAGG - Intergenic
1012887454 6:104861390-104861412 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013102677 6:106999849-106999871 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1013149593 6:107431260-107431282 AGACCCTGTCTCAAGAAAAAAGG - Intronic
1013435817 6:110105403-110105425 AAACCTTGTTTCAAAATGAGAGG + Exonic
1013442651 6:110186713-110186735 AAACCATATCTCAAAAAAATGGG - Intronic
1013552352 6:111220075-111220097 AGACCCTGTCTCAAAATAAAAGG + Intronic
1014231932 6:118913607-118913629 AGACCCTGTCTCAAAAAAACAGG - Intronic
1014589003 6:123238354-123238376 AAACCCCTTCTAAACAAGAGAGG - Intronic
1015215407 6:130744228-130744250 AGACCCTGTCTCAAAAAACAAGG + Intergenic
1015409110 6:132871908-132871930 AGACTCTGTCTCAAAAACAAAGG + Intergenic
1015816087 6:137212265-137212287 AGACTCTGTCTCAAAAGGAGGGG - Intronic
1015828990 6:137347009-137347031 CAACCCTGCCTCAAAAAGAAAGG + Intergenic
1015980067 6:138829730-138829752 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1016488662 6:144571889-144571911 AAAGCATGTCTCCAGAAGAGAGG - Intronic
1016959126 6:149654667-149654689 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017245827 6:152223606-152223628 AGACTCTGTCTCAAAAAGGAAGG + Intronic
1017256117 6:152335697-152335719 AGACTCTGTCTCAAAAAAAAGGG - Intronic
1017435068 6:154408032-154408054 AGACTCCGTCTCAAAAAAAGGGG - Intronic
1017458960 6:154630995-154631017 AAACACCATCTCAAAAAGAAAGG - Intergenic
1017724030 6:157264455-157264477 AGACACTGTCTCAAAAAAGGGGG + Intergenic
1017885659 6:158597508-158597530 AAACCCTGTCTCAAAAAAGGGGG - Intronic
1017893508 6:158658918-158658940 AAACTCCATCTCAAAAAAAGAGG + Intronic
1018015642 6:159710436-159710458 AGACTCTGTCTCAAAAAAAGAGG + Intronic
1018168542 6:161124978-161125000 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1018258973 6:161950533-161950555 AGACTCAGTCTCAAAAAAAGTGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1018673687 6:166200707-166200729 AGACCCTGTCTCAATAAAAAAGG + Intergenic
1018855761 6:167673763-167673785 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1019005515 6:168793454-168793476 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1019090319 6:169525564-169525586 AAAGCTTTTCTCAAAAAGACAGG + Intronic
1019398882 7:839557-839579 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1019489372 7:1304538-1304560 AGACCCTGTCTCTAAAAAAAAGG - Intergenic
1019684238 7:2371759-2371781 ACACCCTGTTTAAAAAAAAGGGG - Exonic
1019965888 7:4498409-4498431 AGACCCTGTCTCTAAAAAATTGG - Intergenic
1020026565 7:4903939-4903961 AAACTCCGTCTCAAAAAAAAAGG - Intergenic
1020036349 7:4965552-4965574 AGACCCTGTCTCAAAAAAATGGG - Intergenic
1020100716 7:5393000-5393022 AGACCCTGTCTCAAAAAAAAGGG + Intronic
1020201939 7:6086733-6086755 AAACTCCATCTCAAAAAGAAAGG - Intergenic
1020262821 7:6540121-6540143 AAACTCCGTCTCAAAAAGAAAGG - Intronic
1021649322 7:22818276-22818298 AGACTCTGTCTCAAAAAGAAAGG - Intronic
1021724298 7:23534495-23534517 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1021734828 7:23632999-23633021 AAACTCCGTCTCAAAAAAAAAGG - Intronic
1021840010 7:24714713-24714735 AAACCCCATCTGAGAAAGAGAGG + Intronic
1022381657 7:29866147-29866169 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1022724942 7:32972725-32972747 AAACTTTGTCTCAAAAAGGGTGG - Intronic
1022760400 7:33343506-33343528 AGACTCTGTCTCAAAAATAAAGG - Intronic
1023059087 7:36312126-36312148 AGACCCTGTCTCAAAAACAGTGG - Intergenic
1023297058 7:38726194-38726216 AAAAACAGTCTCAAAAAGAGTGG + Exonic
1023918529 7:44608396-44608418 AGATCCTGTCTCAAAAAAAAAGG + Intronic
1023953487 7:44866949-44866971 AGACCCTGTCTCAAAAGAAGGGG - Intergenic
1023972695 7:45003082-45003104 AAACTCTATCTCAAAAAAAAAGG - Intronic
1024050671 7:45621074-45621096 GAACCCCGTCTCAAAAAAAAAGG - Intronic
1024176889 7:46849546-46849568 AGATCCTGTCTCAAAAAAAGAGG - Intergenic
1024539586 7:50465378-50465400 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1024678629 7:51660863-51660885 CAACCCTGTTTCCAAATGAGGGG + Intergenic
1024788365 7:52934137-52934159 AAACCCCATCTCAAAAAAAGAGG + Intergenic
1025048658 7:55715109-55715131 AAACTTTGTCTCAAAAAGGGTGG + Intergenic
1025602138 7:63011063-63011085 AGACTCTGTCTTAAAAAAAGAGG - Intergenic
1025706222 7:63866710-63866732 AGACCATGTCTCAAAAAAATAGG - Intergenic
1025765673 7:64445533-64445555 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1025795150 7:64732694-64732716 AGACTCTGTCTCAAAAAGGGGGG - Intergenic
1025950961 7:66145145-66145167 AAACTCTGTCTCAAAAAAAAAGG + Intronic
1026017096 7:66680028-66680050 AGACCATATCTCAAAAAAAGAGG + Intronic
1026285290 7:68957466-68957488 AGACTCCGTCTCAAAAAAAGAGG - Intergenic
1026306551 7:69147455-69147477 AGACCCTGTCTCAAAAAGAGTGG + Intergenic
1026329806 7:69342019-69342041 AGACCATGTCTCAAAAAAAATGG - Intergenic
1026347157 7:69483915-69483937 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
1026543066 7:71297599-71297621 AGACCTTGTCTCAAAAAAATAGG + Intronic
1026803248 7:73413076-73413098 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1026852613 7:73734685-73734707 AGACGTTGTCTCAAAAAGAGAGG - Intergenic
1026912636 7:74100225-74100247 AAACCCTGTCTCAAAAAAATGGG + Intronic
1026919430 7:74144382-74144404 AGACCCTGTCTCAAAGAAAGGGG - Intergenic
1026940546 7:74285354-74285376 AGACCTTGTCTCAAAAAAACTGG - Intergenic
1026967092 7:74447099-74447121 AGACCCTACCTCAAAAAGAAAGG - Intergenic
1026972886 7:74478753-74478775 AGACCCTATCTCAAAAAAAAAGG - Intronic
1027125674 7:75555169-75555191 AGACCCTATCTCAAAAAGCGGGG + Intronic
1027167697 7:75847339-75847361 AGACCCTGTCTCTAAAAAAAAGG - Intronic
1027184437 7:75962301-75962323 AGACCCTGTCTCAAAAAAAAGGG - Intronic
1027522559 7:79228331-79228353 AGACCCTGTCTCAAAAAAACAGG + Intronic
1027795691 7:82691048-82691070 AAATCCTGCATCAAAAAGACAGG - Intergenic
1028384938 7:90244419-90244441 AGACCCTGTCTCAAAAAACCAGG + Intergenic
1028465626 7:91148361-91148383 AGACCCTGTCTCCAAAAAAAAGG + Intronic
1028559124 7:92154247-92154269 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1028594738 7:92536118-92536140 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1028691373 7:93656620-93656642 AGACCCTGTCTCAAACAAAAAGG - Intronic
1029058428 7:97771383-97771405 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1029092033 7:98056084-98056106 AGACCCTGTCTCAAAAAAGAAGG - Intergenic
1029126581 7:98298850-98298872 AAGACCTGTCTCAAAAACAATGG - Intronic
1029133311 7:98350094-98350116 AGACCCTGCCTCAAAAAGGGGGG + Intronic
1029330301 7:99848000-99848022 AAACTCTGTCTCAAAAAAAAGGG + Intronic
1029423012 7:100481116-100481138 AGACTCCGTCTCAAAAAAAGAGG - Intergenic
1029461930 7:100699702-100699724 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
1029528457 7:101109607-101109629 AGACCCTGTTTCAAAAAAAAAGG - Intergenic
1029671700 7:102037183-102037205 AGATCCTGTCTCAAACAGACAGG + Intronic
1029682117 7:102118525-102118547 AGACCCTGTCTAAAAAAAAAGGG + Intronic
1029728091 7:102421496-102421518 AAACCCTGTCTCAAAAAAAAAGG + Intronic
1029826903 7:103207021-103207043 AACCAGTGTATCAAAAAGAGAGG - Intergenic
1029838691 7:103339845-103339867 AAACTCTATCTCAAAAAAAGGGG - Intronic
1029985807 7:104922222-104922244 AAACTCTGTCTCAAAACAGGGGG + Intergenic
1030000455 7:105054159-105054181 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1030339708 7:108363281-108363303 AGAACCTGTCTCAAAAAAAAAGG - Intronic
1030557129 7:111040158-111040180 AAACTCTGTCTCAAAAAAAAGGG + Intronic
1030595015 7:111527405-111527427 AGACCCTGTCTCCAAAAAGGGGG + Intronic
1030627384 7:111859026-111859048 AGACCCTGTCTCAAAAAAAGGGG - Intronic
1031026029 7:116680930-116680952 AGACCCTGTCTCAGAAAAAGTGG + Intronic
1031093776 7:117394112-117394134 AGACCCTGTCTCCTAAAAAGGGG - Intronic
1031141157 7:117945124-117945146 AAATCTTGTCAGAAAAAGAGGGG + Intergenic
1031410323 7:121433678-121433700 AGACTCTGTCTCAAAAGGAAAGG + Intergenic
1032161038 7:129510716-129510738 AGACCCTGTCTCCAAAAAAAAGG + Intronic
1032242749 7:130177522-130177544 AGACCCTTTCTCAAAAGCAGGGG + Intronic
1032757991 7:134909680-134909702 AAACGCAGTCTCAAAAAAAAAGG + Intronic
1033192260 7:139292241-139292263 AGACCCTGTCTCAAAAAAAAGGG + Intronic
1033271230 7:139934820-139934842 AGACTCCGTCTCAAAAAAAGAGG - Intronic
1033835092 7:145300542-145300564 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1033874282 7:145795206-145795228 ATACCCTGTCTCAACAAAAAAGG + Intergenic
1033994241 7:147325930-147325952 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1034167131 7:149034009-149034031 AGACCCCGTCTCAAAAAAGGGGG + Intergenic
1034185971 7:149177422-149177444 AGACCCTGTCTCTAAAAAAAAGG + Intronic
1034484189 7:151347465-151347487 AGACCTTGTCTCAAAAAAAAAGG - Intronic
1034507767 7:151508664-151508686 AAACCCTGTCTCTACAAAAGTGG - Intronic
1034572287 7:151965876-151965898 AGACCCAGTCTCAAAAAAAAGGG + Intronic
1034601860 7:152266252-152266274 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1034684477 7:152958142-152958164 AGACCCTGTCTCAAAAAGAAAGG - Intergenic
1034763943 7:153699855-153699877 AGACCCTGTCTCCAAAAAAGGGG + Intergenic
1034988476 7:155532609-155532631 AGACTCCGTCTCAAAAATAGAGG + Intronic
1035216754 7:157373358-157373380 AAACTCTGTCTCAGAGCGAGGGG - Intronic
1035729646 8:1845128-1845150 AGACCCTGTCTAAAAAATAAAGG + Intronic
1035767044 8:2114481-2114503 AGACTCTGTCTCAAAAAAAGGGG - Intronic
1036557310 8:9871592-9871614 AGACCCTGTCTCAAAAAAAGAGG + Intergenic
1036576741 8:10034482-10034504 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1036647460 8:10620595-10620617 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1037771417 8:21802362-21802384 AGACCCTTTCTCAAAAGAAGAGG - Intronic
1037786629 8:21907194-21907216 AGACCCTGGCTCAAGAAAAGTGG - Intergenic
1037844694 8:22272731-22272753 AAACTCTCTCTCAAAAAAAAAGG - Intergenic
1037850310 8:22322260-22322282 CAACCCTGTCTCAAAAAAAAAGG - Intronic
1037946809 8:22994771-22994793 AGACTCTGTCTCAAAAAGAAAGG - Intronic
1038030527 8:23634581-23634603 AGACCCTGTCTAAGAAAGAAAGG - Intergenic
1038125238 8:24666186-24666208 AAAACCTGTCTCAAATATAATGG + Intergenic
1038199046 8:25394875-25394897 AGTCCCTGTGTCAAAAAGATTGG - Intronic
1038376618 8:27046429-27046451 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1038518091 8:28204332-28204354 AGACCCTGTCTCAAATAAAAGGG + Intergenic
1038529188 8:28303607-28303629 AAACTCTGTCTCAAAAAAAAGGG + Intergenic
1038652579 8:29419165-29419187 AGACCCTGCCTCAAAACAAGGGG - Intergenic
1038794354 8:30696707-30696729 AGACCCTGTCTCAAAAAAAAGGG - Intronic
1038795315 8:30704314-30704336 AGACCCTCTCTCAAAAAGACTGG + Intronic
1039463507 8:37765167-37765189 AAACTCTGTCTCAAAAAAAAAGG + Intronic
1039481866 8:37879871-37879893 AGACTCTGTCTCAAAAAAACAGG + Intronic
1039553197 8:38457971-38457993 AGATTCTGTCTCAAAAAGAGAGG + Intronic
1039716746 8:40118165-40118187 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1039825036 8:41165891-41165913 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1039970200 8:42315667-42315689 AGACTCTGTCTTAAAAAGAAAGG - Intronic
1039975861 8:42364247-42364269 AGACCCTGTTTCAAAAAAAAAGG - Intronic
1040505039 8:48039740-48039762 AAACCCTGTCTCAAAAGAGAAGG - Intronic
1040805996 8:51396747-51396769 AAACTCCGTCTCAAAAATAACGG + Intronic
1041013455 8:53567601-53567623 AGACCCTGTCTCAAAAAAGAAGG - Intergenic
1041086680 8:54263028-54263050 TGACCCTGTCTCAAAAAAAAAGG - Intergenic
1041343593 8:56871842-56871864 ATAACCTGTCTCAAAAAGAAGGG - Intergenic
1042254934 8:66792902-66792924 ACACCCTGTCTCTAAAAGAAAGG + Intronic
1042450734 8:68942533-68942555 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1042793252 8:72632234-72632256 AGACCCTTTCTCAAAAAAATGGG + Intronic
1042911118 8:73827537-73827559 AGACCCTGTCTCAAAACAAAAGG - Intronic
1042921942 8:73928798-73928820 AGACCCTGTCTCAACAAAGGAGG + Intergenic
1043290155 8:78588889-78588911 AGACCCTGTCTCAAAAAGAAAGG + Intronic
1043306249 8:78800305-78800327 AAACCCTGTCTCAAAAAGAGAGG - Intronic
1043434676 8:80226838-80226860 AAACTCTGTCTCAAAAGAAAAGG - Intronic
1043477696 8:80621469-80621491 AGGCCCTGTCTCAAAAAGAAAGG - Intergenic
1043517955 8:81013587-81013609 AGACTCTGTCTCAAAAACAAAGG - Intronic
1043838269 8:85069157-85069179 AAATCCTGTCTCAAAATCAAAGG + Intergenic
1044041042 8:87368625-87368647 AAAACCTATCTCAAAAAGAGAGG + Intronic
1044402134 8:91784738-91784760 TAACACTGACTAAAAAAGAGAGG - Intergenic
1044421008 8:91995775-91995797 AGACCCTGTCTCAAAAAAAAGGG + Intronic
1044561936 8:93620801-93620823 AGACCCTTTCTCAAAAAAAGGGG + Intergenic
1044667746 8:94648245-94648267 AGACCCTGTCTCAAAAAAAGTGG + Intronic
1044689362 8:94861559-94861581 AAACTCCGTCTCAAAAAAAAGGG - Intronic
1045215940 8:100148419-100148441 AGACTCTGTCTCAAAAAAAAGGG - Intergenic
1045278693 8:100729912-100729934 AGACCCTGTCTCGAAAGGAAGGG - Intergenic
1045299349 8:100897843-100897865 AGACCTTGTCTCAAAAAAAGGGG - Intergenic
1045534600 8:103015646-103015668 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1046474236 8:114719680-114719702 AATACCTGTTTCAAGAAGAGTGG - Intergenic
1046929386 8:119827180-119827202 AGATCCTGTCTCAAAAAAAAAGG + Intronic
1047108305 8:121759790-121759812 AGACCCTGTCTCAAATAAAAAGG - Intergenic
1047116776 8:121851313-121851335 TGACCCTGACACAAAAAGAGGGG + Intergenic
1047495589 8:125406447-125406469 AAACCCTGTCTCTACCAAAGGGG - Intergenic
1047748259 8:127861215-127861237 AAACTCTGTCTCAATAAAAAAGG - Intergenic
1048229167 8:132620342-132620364 AGACCCTGTCTCAAGAAAAAAGG - Intronic
1048425803 8:134322389-134322411 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1048461436 8:134624646-134624668 AAACTCTGTCTCAAAAAAATAGG + Intronic
1049098551 8:140563240-140563262 AGACCCTGTCTCAACAAAAGTGG - Intronic
1049129634 8:140826906-140826928 AGACCCTGTCTCTAAAAAAAAGG + Intronic
1049639648 8:143709165-143709187 AGACCCTGTCACAAGATGAGAGG + Intronic
1049727962 8:144159347-144159369 AAACTCCGTGTCAAAAAGAAAGG + Intronic
1049817449 8:144612841-144612863 AGATCCTGTCTCAAAAAAAAAGG + Intergenic
1049853639 8:144848292-144848314 AGACCTTGTCTCAAAAAAAAAGG + Intronic
1049866331 8:144940085-144940107 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1049999200 9:1058337-1058359 AGACCTTGTCTCAAAAAAAAGGG - Intergenic
1050035982 9:1436849-1436871 AGACTCTGTCTCAAAAACAAAGG - Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050540767 9:6667536-6667558 AACCCCCGTCTCATATAGAGGGG - Intergenic
1050568600 9:6914066-6914088 AAACTCCGTCTCAAAAAAAAGGG - Intronic
1050874674 9:10619147-10619169 AGACCCTGTTTCAAAAGAAGGGG - Intergenic
1051073798 9:13206396-13206418 AGACCCTGTCTCAACAAAAAGGG - Intronic
1051088451 9:13379121-13379143 AAACCCTGTTTCAAAAAAGAAGG + Intergenic
1051149655 9:14066523-14066545 AAACCCTGTCTCTAAAAGAAAGG + Intergenic
1051238197 9:15024065-15024087 AGACCCTGTCTCAAAAAAGAAGG - Intergenic
1051464230 9:17359027-17359049 AGACCTTATTTCAAAAAGAGAGG - Intronic
1051642785 9:19238660-19238682 AAATTCTGTCTCAAAAAAAAAGG - Intronic
1052903514 9:33815732-33815754 AGACCCTGTCTCAATAAAAGGGG + Intergenic
1052935880 9:34092852-34092874 AAATTCTGTCTCAAAAAAAAAGG - Intronic
1053224390 9:36340393-36340415 TAACCCTGTCTCAAAAAACGGGG - Intronic
1053251782 9:36580326-36580348 AAACTCCGTCTCAAAAAAAAAGG - Intronic
1053254528 9:36604651-36604673 AGACCCTGTCTCAAAAAAAAGGG - Intronic
1053330805 9:37205524-37205546 AGACTCCGTCTCAAAAAAAGTGG - Intronic
1053421463 9:37982481-37982503 AAACTCCGTCTCAAAAAAAATGG + Intronic
1053440163 9:38109390-38109412 AAATCCTGTCTCAAAAAAAAGGG - Intergenic
1053488192 9:38477905-38477927 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1053655565 9:40215499-40215521 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1053905934 9:42844716-42844738 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1054367683 9:64361729-64361751 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1054675300 9:67851464-67851486 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1054937601 9:70705295-70705317 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1054939292 9:70723288-70723310 AGACCCTGTCTCAAAAAGAAAGG - Intronic
1055947446 9:81704146-81704168 AGACCTTGTCTCAAAAAAAAAGG + Intergenic
1056192775 9:84200356-84200378 AGACGCTGTCTCTAAAACAGAGG + Intergenic
1056298853 9:85221305-85221327 AGACCCTGTCTCAAAAAAGTAGG + Intergenic
1056397562 9:86195696-86195718 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1056770286 9:89473554-89473576 AGACCCTGTCTCAAAAACAACGG + Intronic
1057091874 9:92265664-92265686 AGACCCTATCTCAAAAAAAAAGG - Intronic
1057187316 9:93064056-93064078 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1057214859 9:93222176-93222198 AGACCCTGCCTCAAAAAAAGGGG - Intronic
1057214940 9:93222689-93222711 AAACTCTGTCTCAAAAAAAAAGG - Intronic
1057374236 9:94504048-94504070 AGACCCTGTCTCAAAAAAAAAGG + Intergenic
1057450538 9:95155195-95155217 AGACCCTGTCAAAAAAAGAAAGG + Intronic
1057966175 9:99505491-99505513 AGACCCTGTCTCAAAAAAGGGGG + Intergenic
1058155379 9:101508913-101508935 AAACCCTGTTTCACAAAGGTAGG + Intronic
1058334922 9:103814573-103814595 AGCCTCTGTCTCAAACAGAGAGG + Intergenic
1058493921 9:105533729-105533751 AAACTCTGTCTTAAAAAAAAAGG - Intronic
1058507059 9:105676784-105676806 AAAAAGTGTCTCACAAAGAGGGG - Intergenic
1058596353 9:106620009-106620031 ATTCCCTGTGTCAAGAAGAGTGG - Intergenic
1058737463 9:107906993-107907015 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1058929341 9:109703661-109703683 AAACCCATTCTCTAAAAGACAGG + Intronic
1058968297 9:110057141-110057163 AGACCCTGTCTCTAAAAAAGTGG - Intronic
1058975267 9:110120510-110120532 AGACTCTGTCTCAAAAACAAAGG - Intronic
1059294246 9:113255664-113255686 AGACCCTGTCTCAAAAAAAAAGG + Intronic
1059449891 9:114364022-114364044 AAACCCTGTTAAAAAAAGTGGGG - Intronic
1059524471 9:114977669-114977691 AGACCCTGTCTCTAAAAGAGGGG - Intergenic
1059989071 9:119847557-119847579 AAAGTCTGTCTCAACAAGACTGG + Intergenic
1060049666 9:120369252-120369274 AGAGTCTGTCTCAAAAAAAGAGG - Intergenic
1060182428 9:121543674-121543696 AGACCCTGTCCCAAAAAAACAGG - Intergenic
1060187138 9:121570556-121570578 AGACCCTGTCTCAATAAAAAAGG - Intronic
1060392010 9:123285511-123285533 AAACCCTGTCTCTAAACAAAAGG - Intergenic
1060632473 9:125172225-125172247 AGACTCTGTCTCAAAAAAAAAGG - Intronic
1060669041 9:125452107-125452129 AGACTCTGTCTCAAAAAAACGGG - Intronic
1060724169 9:125996314-125996336 AGACTCTGTCTCAAAAAAAAGGG - Intergenic
1060740499 9:126094863-126094885 AGACCCTGTCTCAAAAAAAAGGG + Intergenic
1060950926 9:127602179-127602201 AGACCCTGTCTCAAAAAGGAAGG - Intergenic
1061356042 9:130105833-130105855 AAACCCTGTCTACAAAAAATTGG - Intronic
1061459817 9:130728393-130728415 AAACACTGTCTCAAAAAAAAAGG - Intronic
1061508124 9:131043920-131043942 CAGCCCAGTCTCAAAAAGAGGGG - Intronic
1061518115 9:131101354-131101376 AGACCCTGTCTCAAAAAAAAAGG - Intronic
1061980026 9:134097102-134097124 AAACTCTGACTCAAAAAAAAAGG + Intergenic
1062301477 9:135874461-135874483 AGACCCTGTCTCAAAAAAGGGGG + Intronic
1062492970 9:136816705-136816727 AGACTCTGTCTCAAAAAAAAGGG + Intronic
1202803475 9_KI270720v1_random:24614-24636 AAACCATGTGTCAAGAAGGGGGG + Intergenic
1202803485 9_KI270720v1_random:24726-24748 AAACCATGTGTCAAGAAGGGGGG + Intergenic
1203552585 Un_KI270743v1:176529-176551 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1186433581 X:9524759-9524781 AAACCCTGTCTCAAAACAAAAGG - Intronic
1187064923 X:15824230-15824252 AGACCCTGTCTCTAAAAAAAGGG - Intergenic
1187255094 X:17635250-17635272 ACACCCTGTCTCCAGAGGAGGGG - Intronic
1187310039 X:18133105-18133127 AGACCTTGTCTCAATAAAAGTGG + Intergenic
1187448351 X:19376453-19376475 AGACCCTGTCTCAAAAAGTTGGG - Intronic
1187613512 X:20968605-20968627 AAACTCCGTCTCAAAAAAAAAGG + Intergenic
1187908319 X:24087717-24087739 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1187995496 X:24922081-24922103 AGATCCTGTCTCAAAAAAAGGGG - Intronic
1188014534 X:25093712-25093734 AGACCCTGTCTGAAAAAAAAAGG - Intergenic
1188141406 X:26556938-26556960 AGACCCTGTCTCAAAAAAAAGGG - Intergenic
1188178694 X:27026382-27026404 AGACTCTGTCTCAAAAAAAGGGG - Intergenic
1189448461 X:41104074-41104096 AGAACCTGTCTCAAAAAAGGGGG - Intronic
1189796689 X:44652522-44652544 AGACCCTGTCTCAAGAAAAAGGG - Intergenic
1190082140 X:47364953-47364975 ATACCCTGTCTAAAAAAGAAAGG - Intergenic
1190122900 X:47677418-47677440 AATCCTTGTCTCAAAAATAAGGG - Intergenic
1190303685 X:49070713-49070735 AGAACCTGTCTCAAAAAGCTGGG - Intergenic
1190635767 X:52432368-52432390 AAATCCTGTCTGAAAAAGGGTGG - Intergenic
1190656691 X:52618853-52618875 AAAACCTATTTCAAAACGAGAGG + Intergenic
1190764352 X:53463796-53463818 AGACCCTGTCTCAAAAAAAAAGG - Intergenic
1190808123 X:53859206-53859228 AGACCCTTTCTCAAAAAAGGTGG - Intergenic
1190890893 X:54566783-54566805 AGATCCTGTCTCAAAATAAGGGG - Intergenic
1191682779 X:63858198-63858220 AGACCCTGTCTCAAAAAAAGAGG + Intergenic
1192000143 X:67141023-67141045 AAACCCTGAAAAAAAAAGAGAGG - Intergenic
1192123768 X:68481659-68481681 AGACCCTGTCACAAAAAAAAAGG - Intergenic
1192285957 X:69736294-69736316 AAACTCCGTCTCAAAAAAAAAGG + Intronic
1192402174 X:70846912-70846934 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1192420250 X:71023015-71023037 AGACCCTGTCTCAGAAGGACAGG + Intergenic
1192425890 X:71076060-71076082 AAACTCCGTCTCAAAAAAAGAGG + Intergenic
1192427973 X:71094175-71094197 AGACCCTGTCTCAAAAAAGAAGG + Intergenic
1193119421 X:77807861-77807883 AAACTCCGTCTCAAAAAAAAAGG - Intergenic
1193119470 X:77808181-77808203 AGACCCTGTCTCAGAAAAAAAGG - Intergenic
1193677413 X:84472723-84472745 AAACCCTGAGTCAAAAAGTAAGG + Intronic
1193740427 X:85210219-85210241 AGATCCGGTCTCAGAAAGAGTGG - Intergenic
1194153850 X:90362459-90362481 AAACTCTGTCTCAAAAAAAAAGG - Intergenic
1195055624 X:101141744-101141766 AGACCCTGTCTCAATAAAAAAGG - Intronic
1195057356 X:101159169-101159191 AGACTCTGTCTCAAAAAAAAGGG - Intronic
1195132369 X:101865900-101865922 AGACTCTGTCTCAAAAAAAAAGG + Intergenic
1195137397 X:101922783-101922805 AAATCATGTCTCAAATAGTGGGG - Intronic
1195208353 X:102626032-102626054 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1195648298 X:107258039-107258061 AGACTCTGTCTCAAAAAAAACGG + Intergenic
1195693504 X:107649092-107649114 AGACCCTGTCTAAAAAAAAATGG - Intronic
1195757194 X:108211067-108211089 AAACCCTGGCTCCAAATGATTGG - Intronic
1195864644 X:109416483-109416505 ATACCCAGTCTGAAAAACAGAGG + Intronic
1196199289 X:112867340-112867362 AAACCCTGACTCCAAGATAGTGG + Intergenic
1196709047 X:118743625-118743647 AATTCCTTTCTCAAAAAGAAAGG - Intronic
1196766831 X:119253626-119253648 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1197128058 X:122971198-122971220 ATACTCTTTCTCAAAAAGTGTGG - Intergenic
1197211469 X:123831603-123831625 AAACTCCGTCTCAAAAAAAAAGG - Intergenic
1197327221 X:125108685-125108707 AGACTCTGTCTCAAAAAAAAGGG + Intergenic
1197806233 X:130401149-130401171 AGACCCTGTCTCTAAAATAAAGG - Intergenic
1198212626 X:134529911-134529933 AAACTCCGTCTCAAAAAAAAGGG - Intergenic
1198323244 X:135540764-135540786 AGGCCCTGTCTCAAAAAAAAGGG - Intronic
1198340311 X:135707736-135707758 AAACCCTGTCTCAAAAAGAATGG - Intergenic
1198343792 X:135740453-135740475 AAACCCTGTCTCAAAAAGAATGG - Intergenic
1198515604 X:137403671-137403693 AGACCCTGTCTCTAAAAGAAAGG + Intergenic
1199107136 X:143883617-143883639 AGACTCCGTCTCAAAAAGAAAGG - Intergenic
1199830477 X:151544729-151544751 AGACCCTGTCTCAAAAACAGAGG + Intergenic
1200185744 X:154182308-154182330 AGACTCTGTCTAAAAAAAAGTGG - Intergenic
1200191396 X:154219446-154219468 AGACTCTGTCTAAAAAAAAGTGG - Intergenic
1200197151 X:154257250-154257272 AGACTCTGTCTAAAAAAAAGTGG - Intergenic
1200241664 X:154498527-154498549 AGACCCTGTCTCAAAAACAGTGG - Intergenic
1200500200 Y:3939338-3939360 AGACTCTGTCTCAAAAAAAAAGG - Intergenic
1200714085 Y:6517930-6517952 AGAACTTGTCTCAAAAAAAGGGG + Intergenic
1200797344 Y:7353035-7353057 AGACCTTGTCTCAAAAAAAAAGG + Intergenic
1201019739 Y:9643224-9643246 AGAACTTGTCTCAAAAAAAGGGG - Intergenic
1201153851 Y:11112100-11112122 AGACTCTGTCTCAAAAAAAGGGG - Intergenic
1201285688 Y:12376791-12376813 CAACCCTGTCTCAGAAAAAAAGG - Intergenic
1201372505 Y:13280378-13280400 AAACTCTGTCTCAAAAAAAAAGG + Intronic
1201379204 Y:13354386-13354408 AGACTCTGTCTCAAAAAAAAAGG + Intronic
1201986643 Y:19975597-19975619 AAAGCCTGTCCAAAAAAGAAAGG - Intergenic
1202083516 Y:21110495-21110517 AGACTCTGTCTCAAAAAAAAAGG - Intergenic