ID: 1043306249

View in Genome Browser
Species Human (GRCh38)
Location 8:78800305-78800327
Sequence AAACCCTGTCTCAAAAAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043306249_1043306251 -3 Left 1043306249 8:78800305-78800327 CCTCTCTTTTTGAGACAGGGTTT No data
Right 1043306251 8:78800325-78800347 TTTCACTCTGCTGCCCAGGCTGG No data
1043306249_1043306252 7 Left 1043306249 8:78800305-78800327 CCTCTCTTTTTGAGACAGGGTTT No data
Right 1043306252 8:78800335-78800357 CTGCCCAGGCTGGAGTGCAGTGG No data
1043306249_1043306250 -7 Left 1043306249 8:78800305-78800327 CCTCTCTTTTTGAGACAGGGTTT No data
Right 1043306250 8:78800321-78800343 AGGGTTTCACTCTGCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043306249 Original CRISPR AAACCCTGTCTCAAAAAGAG AGG (reversed) Intronic