ID: 1043306250

View in Genome Browser
Species Human (GRCh38)
Location 8:78800321-78800343
Sequence AGGGTTTCACTCTGCTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043306245_1043306250 13 Left 1043306245 8:78800285-78800307 CCACATTTTCTTTTTTTCTCCCT No data
Right 1043306250 8:78800321-78800343 AGGGTTTCACTCTGCTGCCCAGG No data
1043306248_1043306250 -6 Left 1043306248 8:78800304-78800326 CCCTCTCTTTTTGAGACAGGGTT No data
Right 1043306250 8:78800321-78800343 AGGGTTTCACTCTGCTGCCCAGG No data
1043306249_1043306250 -7 Left 1043306249 8:78800305-78800327 CCTCTCTTTTTGAGACAGGGTTT No data
Right 1043306250 8:78800321-78800343 AGGGTTTCACTCTGCTGCCCAGG No data
1043306244_1043306250 29 Left 1043306244 8:78800269-78800291 CCATGGTATACATATACCACATT No data
Right 1043306250 8:78800321-78800343 AGGGTTTCACTCTGCTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043306250 Original CRISPR AGGGTTTCACTCTGCTGCCC AGG Intronic