ID: 1043306252

View in Genome Browser
Species Human (GRCh38)
Location 8:78800335-78800357
Sequence CTGCCCAGGCTGGAGTGCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043306249_1043306252 7 Left 1043306249 8:78800305-78800327 CCTCTCTTTTTGAGACAGGGTTT No data
Right 1043306252 8:78800335-78800357 CTGCCCAGGCTGGAGTGCAGTGG No data
1043306248_1043306252 8 Left 1043306248 8:78800304-78800326 CCCTCTCTTTTTGAGACAGGGTT No data
Right 1043306252 8:78800335-78800357 CTGCCCAGGCTGGAGTGCAGTGG No data
1043306245_1043306252 27 Left 1043306245 8:78800285-78800307 CCACATTTTCTTTTTTTCTCCCT No data
Right 1043306252 8:78800335-78800357 CTGCCCAGGCTGGAGTGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043306252 Original CRISPR CTGCCCAGGCTGGAGTGCAG TGG Intronic