ID: 1043307492

View in Genome Browser
Species Human (GRCh38)
Location 8:78814537-78814559
Sequence AATCTTAGCAGATCAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043307492_1043307495 13 Left 1043307492 8:78814537-78814559 CCTGTTTTTGATCTGCTAAGATT No data
Right 1043307495 8:78814573-78814595 TAATTGACAATCTTGGAAGGAGG No data
1043307492_1043307493 6 Left 1043307492 8:78814537-78814559 CCTGTTTTTGATCTGCTAAGATT No data
Right 1043307493 8:78814566-78814588 TTCTTGATAATTGACAATCTTGG No data
1043307492_1043307494 10 Left 1043307492 8:78814537-78814559 CCTGTTTTTGATCTGCTAAGATT No data
Right 1043307494 8:78814570-78814592 TGATAATTGACAATCTTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043307492 Original CRISPR AATCTTAGCAGATCAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr