ID: 1043317954

View in Genome Browser
Species Human (GRCh38)
Location 8:78944584-78944606
Sequence ATTTATACACACATAAATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043317954_1043317957 6 Left 1043317954 8:78944584-78944606 CCCAGATTTATGTGTGTATAAAT No data
Right 1043317957 8:78944613-78944635 AATCATTCTGTTCTTCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043317954 Original CRISPR ATTTATACACACATAAATCT GGG (reversed) Intergenic
No off target data available for this crispr