ID: 1043321304

View in Genome Browser
Species Human (GRCh38)
Location 8:78989917-78989939
Sequence ATCAAATTCTTTAGATAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043321303_1043321304 -4 Left 1043321303 8:78989898-78989920 CCTTCAGAAAAAAAAAAAAATCA No data
Right 1043321304 8:78989917-78989939 ATCAAATTCTTTAGATAAAAAGG No data
1043321302_1043321304 30 Left 1043321302 8:78989864-78989886 CCATGTTATTATTCTGTTTAAAT No data
Right 1043321304 8:78989917-78989939 ATCAAATTCTTTAGATAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043321304 Original CRISPR ATCAAATTCTTTAGATAAAA AGG Intergenic
No off target data available for this crispr