ID: 1043325044

View in Genome Browser
Species Human (GRCh38)
Location 8:79039759-79039781
Sequence TGTCATTTGCAGGACATGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043325041_1043325044 16 Left 1043325041 8:79039720-79039742 CCATGGAATACTATGTGATCATA No data
Right 1043325044 8:79039759-79039781 TGTCATTTGCAGGACATGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043325044 Original CRISPR TGTCATTTGCAGGACATGAT TGG Intergenic
No off target data available for this crispr