ID: 1043326195

View in Genome Browser
Species Human (GRCh38)
Location 8:79054882-79054904
Sequence GAGCAAGGTAACCTGAGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043326195_1043326203 30 Left 1043326195 8:79054882-79054904 CCCAGACTCAGGTTACCTTGCTC No data
Right 1043326203 8:79054935-79054957 TTTCCCATTATCAAGGGACATGG No data
1043326195_1043326200 23 Left 1043326195 8:79054882-79054904 CCCAGACTCAGGTTACCTTGCTC No data
Right 1043326200 8:79054928-79054950 CAGTGCCTTTCCCATTATCAAGG No data
1043326195_1043326199 -8 Left 1043326195 8:79054882-79054904 CCCAGACTCAGGTTACCTTGCTC No data
Right 1043326199 8:79054897-79054919 CCTTGCTCTTTTCAGGTCACAGG No data
1043326195_1043326201 24 Left 1043326195 8:79054882-79054904 CCCAGACTCAGGTTACCTTGCTC No data
Right 1043326201 8:79054929-79054951 AGTGCCTTTCCCATTATCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043326195 Original CRISPR GAGCAAGGTAACCTGAGTCT GGG (reversed) Intergenic
No off target data available for this crispr