ID: 1043333854

View in Genome Browser
Species Human (GRCh38)
Location 8:79149740-79149762
Sequence TGACATGGCAAGAGAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043333854_1043333864 12 Left 1043333854 8:79149740-79149762 CCCTCCCCTCTCTTGCCATGTCA No data
Right 1043333864 8:79149775-79149797 CCTTAGCTTTCTACCATTAGTGG No data
1043333854_1043333866 25 Left 1043333854 8:79149740-79149762 CCCTCCCCTCTCTTGCCATGTCA No data
Right 1043333866 8:79149788-79149810 CCATTAGTGGAAGCTTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043333854 Original CRISPR TGACATGGCAAGAGAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr