ID: 1043334336

View in Genome Browser
Species Human (GRCh38)
Location 8:79155537-79155559
Sequence GAGCCTGGTGGGAGATATCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043334324_1043334336 23 Left 1043334324 8:79155491-79155513 CCTCTCCAAATCTCACCTTGAGA No data
Right 1043334336 8:79155537-79155559 GAGCCTGGTGGGAGATATCGGGG No data
1043334325_1043334336 18 Left 1043334325 8:79155496-79155518 CCAAATCTCACCTTGAGATATAA No data
Right 1043334336 8:79155537-79155559 GAGCCTGGTGGGAGATATCGGGG No data
1043334330_1043334336 -6 Left 1043334330 8:79155520-79155542 CCTGAGTGTTGGAGGTGGAGCCT No data
Right 1043334336 8:79155537-79155559 GAGCCTGGTGGGAGATATCGGGG No data
1043334326_1043334336 8 Left 1043334326 8:79155506-79155528 CCTTGAGATATAATCCTGAGTGT No data
Right 1043334336 8:79155537-79155559 GAGCCTGGTGGGAGATATCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043334336 Original CRISPR GAGCCTGGTGGGAGATATCG GGG Intergenic
No off target data available for this crispr