ID: 1043337421

View in Genome Browser
Species Human (GRCh38)
Location 8:79193614-79193636
Sequence AACCCACTCCTTGTTCCTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043337421_1043337424 29 Left 1043337421 8:79193614-79193636 CCACAAGGAACAAGGAGTGGGTT No data
Right 1043337424 8:79193666-79193688 TTGATTTACAAAAATAATAGTGG No data
1043337421_1043337423 -2 Left 1043337421 8:79193614-79193636 CCACAAGGAACAAGGAGTGGGTT No data
Right 1043337423 8:79193635-79193657 TTGGCACAAAGTTGTTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043337421 Original CRISPR AACCCACTCCTTGTTCCTTG TGG (reversed) Intergenic
No off target data available for this crispr