ID: 1043337423

View in Genome Browser
Species Human (GRCh38)
Location 8:79193635-79193657
Sequence TTGGCACAAAGTTGTTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043337421_1043337423 -2 Left 1043337421 8:79193614-79193636 CCACAAGGAACAAGGAGTGGGTT No data
Right 1043337423 8:79193635-79193657 TTGGCACAAAGTTGTTTGACAGG No data
1043337414_1043337423 12 Left 1043337414 8:79193600-79193622 CCCTCCAGCCTAGACCACAAGGA No data
Right 1043337423 8:79193635-79193657 TTGGCACAAAGTTGTTTGACAGG No data
1043337415_1043337423 11 Left 1043337415 8:79193601-79193623 CCTCCAGCCTAGACCACAAGGAA No data
Right 1043337423 8:79193635-79193657 TTGGCACAAAGTTGTTTGACAGG No data
1043337418_1043337423 4 Left 1043337418 8:79193608-79193630 CCTAGACCACAAGGAACAAGGAG No data
Right 1043337423 8:79193635-79193657 TTGGCACAAAGTTGTTTGACAGG No data
1043337411_1043337423 28 Left 1043337411 8:79193584-79193606 CCATGATGACAGCTGCCCCTCCA No data
Right 1043337423 8:79193635-79193657 TTGGCACAAAGTTGTTTGACAGG No data
1043337412_1043337423 13 Left 1043337412 8:79193599-79193621 CCCCTCCAGCCTAGACCACAAGG No data
Right 1043337423 8:79193635-79193657 TTGGCACAAAGTTGTTTGACAGG No data
1043337416_1043337423 8 Left 1043337416 8:79193604-79193626 CCAGCCTAGACCACAAGGAACAA No data
Right 1043337423 8:79193635-79193657 TTGGCACAAAGTTGTTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043337423 Original CRISPR TTGGCACAAAGTTGTTTGAC AGG Intergenic
No off target data available for this crispr