ID: 1043337424

View in Genome Browser
Species Human (GRCh38)
Location 8:79193666-79193688
Sequence TTGATTTACAAAAATAATAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043337421_1043337424 29 Left 1043337421 8:79193614-79193636 CCACAAGGAACAAGGAGTGGGTT No data
Right 1043337424 8:79193666-79193688 TTGATTTACAAAAATAATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043337424 Original CRISPR TTGATTTACAAAAATAATAG TGG Intergenic
No off target data available for this crispr