ID: 1043338425

View in Genome Browser
Species Human (GRCh38)
Location 8:79206773-79206795
Sequence AGAATGGTGTGAACCCCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2703
Summary {0: 18, 1: 377, 2: 450, 3: 646, 4: 1212}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043338425_1043338435 12 Left 1043338425 8:79206773-79206795 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1043338435 8:79206808-79206830 TCCCGAGTAGCTGGGAGTACAGG 0: 575
1: 101213
2: 283358
3: 234404
4: 144267
1043338425_1043338433 4 Left 1043338425 8:79206773-79206795 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1043338433 8:79206800-79206822 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1043338425_1043338431 3 Left 1043338425 8:79206773-79206795 CCCCCTGGGGTTCACACCATTCT 0: 18
1: 377
2: 450
3: 646
4: 1212
Right 1043338431 8:79206799-79206821 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043338425 Original CRISPR AGAATGGTGTGAACCCCAGG GGG (reversed) Intergenic
Too many off-targets to display for this crispr