ID: 1043341124

View in Genome Browser
Species Human (GRCh38)
Location 8:79240952-79240974
Sequence ATGGTGTTATTTATGAAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043341120_1043341124 17 Left 1043341120 8:79240912-79240934 CCAAATGAAGAGATGTCATGACA No data
Right 1043341124 8:79240952-79240974 ATGGTGTTATTTATGAAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043341124 Original CRISPR ATGGTGTTATTTATGAAAAT GGG Intergenic
No off target data available for this crispr