ID: 1043347961

View in Genome Browser
Species Human (GRCh38)
Location 8:79322236-79322258
Sequence GTGTTCATGGATAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043347954_1043347961 20 Left 1043347954 8:79322193-79322215 CCTGCTGTTCTATCTGTTTGACC No data
Right 1043347961 8:79322236-79322258 GTGTTCATGGATAAGGAGGAAGG No data
1043347953_1043347961 28 Left 1043347953 8:79322185-79322207 CCATTAGGCCTGCTGTTCTATCT No data
Right 1043347961 8:79322236-79322258 GTGTTCATGGATAAGGAGGAAGG No data
1043347955_1043347961 -1 Left 1043347955 8:79322214-79322236 CCTATGCTAATTTTTGCCCTCAG No data
Right 1043347961 8:79322236-79322258 GTGTTCATGGATAAGGAGGAAGG No data
1043347952_1043347961 29 Left 1043347952 8:79322184-79322206 CCCATTAGGCCTGCTGTTCTATC No data
Right 1043347961 8:79322236-79322258 GTGTTCATGGATAAGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043347961 Original CRISPR GTGTTCATGGATAAGGAGGA AGG Intergenic
No off target data available for this crispr