ID: 1043350094

View in Genome Browser
Species Human (GRCh38)
Location 8:79349996-79350018
Sequence TTGGGTCCCCCATAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043350086_1043350094 3 Left 1043350086 8:79349970-79349992 CCTGTGCTCATCCATTTCAGAAC No data
Right 1043350094 8:79349996-79350018 TTGGGTCCCCCATAGGAAGTGGG No data
1043350081_1043350094 25 Left 1043350081 8:79349948-79349970 CCCTGAAACACTGGGCCCTCTCC No data
Right 1043350094 8:79349996-79350018 TTGGGTCCCCCATAGGAAGTGGG No data
1043350083_1043350094 10 Left 1043350083 8:79349963-79349985 CCCTCTCCCTGTGCTCATCCATT No data
Right 1043350094 8:79349996-79350018 TTGGGTCCCCCATAGGAAGTGGG No data
1043350082_1043350094 24 Left 1043350082 8:79349949-79349971 CCTGAAACACTGGGCCCTCTCCC No data
Right 1043350094 8:79349996-79350018 TTGGGTCCCCCATAGGAAGTGGG No data
1043350085_1043350094 4 Left 1043350085 8:79349969-79349991 CCCTGTGCTCATCCATTTCAGAA No data
Right 1043350094 8:79349996-79350018 TTGGGTCCCCCATAGGAAGTGGG No data
1043350084_1043350094 9 Left 1043350084 8:79349964-79349986 CCTCTCCCTGTGCTCATCCATTT No data
Right 1043350094 8:79349996-79350018 TTGGGTCCCCCATAGGAAGTGGG No data
1043350089_1043350094 -8 Left 1043350089 8:79349981-79350003 CCATTTCAGAACCCTTTGGGTCC No data
Right 1043350094 8:79349996-79350018 TTGGGTCCCCCATAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043350094 Original CRISPR TTGGGTCCCCCATAGGAAGT GGG Intergenic
No off target data available for this crispr