ID: 1043351942

View in Genome Browser
Species Human (GRCh38)
Location 8:79372269-79372291
Sequence TTTAAGTTGTTTGTAGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043351942_1043351943 19 Left 1043351942 8:79372269-79372291 CCAGAAGCTACAAACAACTTAAA No data
Right 1043351943 8:79372311-79372333 CAAACAACCCCATCAAAAAGTGG 0: 10373
1: 8887
2: 6604
3: 5338
4: 4956
1043351942_1043351946 26 Left 1043351942 8:79372269-79372291 CCAGAAGCTACAAACAACTTAAA No data
Right 1043351946 8:79372318-79372340 CCCCATCAAAAAGTGGGCAAAGG 0: 6124
1: 9463
2: 8884
3: 6269
4: 4306
1043351942_1043351944 20 Left 1043351942 8:79372269-79372291 CCAGAAGCTACAAACAACTTAAA No data
Right 1043351944 8:79372312-79372334 AAACAACCCCATCAAAAAGTGGG 0: 13012
1: 9080
2: 6221
3: 4793
4: 4380

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043351942 Original CRISPR TTTAAGTTGTTTGTAGCTTC TGG (reversed) Intergenic
No off target data available for this crispr