ID: 1043354457

View in Genome Browser
Species Human (GRCh38)
Location 8:79395950-79395972
Sequence GCAATGTCCACAGCTCTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043354457_1043354458 -7 Left 1043354457 8:79395950-79395972 CCAAAAAGAGCTGTGGACATTGC No data
Right 1043354458 8:79395966-79395988 ACATTGCCAAATGTTTTCTAAGG No data
1043354457_1043354460 10 Left 1043354457 8:79395950-79395972 CCAAAAAGAGCTGTGGACATTGC No data
Right 1043354460 8:79395983-79396005 CTAAGGAGTAAATTCACCCCTGG No data
1043354457_1043354463 27 Left 1043354457 8:79395950-79395972 CCAAAAAGAGCTGTGGACATTGC No data
Right 1043354463 8:79396000-79396022 CCCTGGTTGAGACTAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043354457 Original CRISPR GCAATGTCCACAGCTCTTTT TGG (reversed) Intergenic