ID: 1043354458

View in Genome Browser
Species Human (GRCh38)
Location 8:79395966-79395988
Sequence ACATTGCCAAATGTTTTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043354452_1043354458 30 Left 1043354452 8:79395913-79395935 CCATTACATGCTACTAGTACCCC No data
Right 1043354458 8:79395966-79395988 ACATTGCCAAATGTTTTCTAAGG No data
1043354455_1043354458 9 Left 1043354455 8:79395934-79395956 CCTTCAATTGTGACTACCAAAAA No data
Right 1043354458 8:79395966-79395988 ACATTGCCAAATGTTTTCTAAGG No data
1043354453_1043354458 11 Left 1043354453 8:79395932-79395954 CCCCTTCAATTGTGACTACCAAA No data
Right 1043354458 8:79395966-79395988 ACATTGCCAAATGTTTTCTAAGG No data
1043354457_1043354458 -7 Left 1043354457 8:79395950-79395972 CCAAAAAGAGCTGTGGACATTGC No data
Right 1043354458 8:79395966-79395988 ACATTGCCAAATGTTTTCTAAGG No data
1043354454_1043354458 10 Left 1043354454 8:79395933-79395955 CCCTTCAATTGTGACTACCAAAA No data
Right 1043354458 8:79395966-79395988 ACATTGCCAAATGTTTTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043354458 Original CRISPR ACATTGCCAAATGTTTTCTA AGG Intergenic