ID: 1043354459

View in Genome Browser
Species Human (GRCh38)
Location 8:79395972-79395994
Sequence TTTACTCCTTAGAAAACATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043354459_1043354463 5 Left 1043354459 8:79395972-79395994 CCAAATGTTTTCTAAGGAGTAAA No data
Right 1043354463 8:79396000-79396022 CCCTGGTTGAGACTAGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043354459 Original CRISPR TTTACTCCTTAGAAAACATT TGG (reversed) Intergenic