ID: 1043354460

View in Genome Browser
Species Human (GRCh38)
Location 8:79395983-79396005
Sequence CTAAGGAGTAAATTCACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043354457_1043354460 10 Left 1043354457 8:79395950-79395972 CCAAAAAGAGCTGTGGACATTGC No data
Right 1043354460 8:79395983-79396005 CTAAGGAGTAAATTCACCCCTGG No data
1043354455_1043354460 26 Left 1043354455 8:79395934-79395956 CCTTCAATTGTGACTACCAAAAA No data
Right 1043354460 8:79395983-79396005 CTAAGGAGTAAATTCACCCCTGG No data
1043354453_1043354460 28 Left 1043354453 8:79395932-79395954 CCCCTTCAATTGTGACTACCAAA No data
Right 1043354460 8:79395983-79396005 CTAAGGAGTAAATTCACCCCTGG No data
1043354454_1043354460 27 Left 1043354454 8:79395933-79395955 CCCTTCAATTGTGACTACCAAAA No data
Right 1043354460 8:79395983-79396005 CTAAGGAGTAAATTCACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043354460 Original CRISPR CTAAGGAGTAAATTCACCCC TGG Intergenic