ID: 1043355246

View in Genome Browser
Species Human (GRCh38)
Location 8:79403833-79403855
Sequence CAAACTCAAGTTTTTCTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043355246_1043355249 12 Left 1043355246 8:79403833-79403855 CCCGGAAGAAAAACTTGAGTTTG No data
Right 1043355249 8:79403868-79403890 CGGTTCTTATCCCTTCTCCAAGG No data
1043355246_1043355248 -8 Left 1043355246 8:79403833-79403855 CCCGGAAGAAAAACTTGAGTTTG No data
Right 1043355248 8:79403848-79403870 TGAGTTTGATTTTTCTCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043355246 Original CRISPR CAAACTCAAGTTTTTCTTCC GGG (reversed) Intergenic