ID: 1043355247

View in Genome Browser
Species Human (GRCh38)
Location 8:79403834-79403856
Sequence TCAAACTCAAGTTTTTCTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043355247_1043355249 11 Left 1043355247 8:79403834-79403856 CCGGAAGAAAAACTTGAGTTTGA No data
Right 1043355249 8:79403868-79403890 CGGTTCTTATCCCTTCTCCAAGG No data
1043355247_1043355248 -9 Left 1043355247 8:79403834-79403856 CCGGAAGAAAAACTTGAGTTTGA No data
Right 1043355248 8:79403848-79403870 TGAGTTTGATTTTTCTCTTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043355247 Original CRISPR TCAAACTCAAGTTTTTCTTC CGG (reversed) Intergenic