ID: 1043355249 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 8:79403868-79403890 |
Sequence | CGGTTCTTATCCCTTCTCCA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1043355246_1043355249 | 12 | Left | 1043355246 | 8:79403833-79403855 | CCCGGAAGAAAAACTTGAGTTTG | No data | ||
Right | 1043355249 | 8:79403868-79403890 | CGGTTCTTATCCCTTCTCCAAGG | No data | ||||
1043355247_1043355249 | 11 | Left | 1043355247 | 8:79403834-79403856 | CCGGAAGAAAAACTTGAGTTTGA | No data | ||
Right | 1043355249 | 8:79403868-79403890 | CGGTTCTTATCCCTTCTCCAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1043355249 | Original CRISPR | CGGTTCTTATCCCTTCTCCA AGG | Intergenic | ||