ID: 1043358192

View in Genome Browser
Species Human (GRCh38)
Location 8:79438768-79438790
Sequence CAGAAGAAGGAGAACTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043358189_1043358192 -7 Left 1043358189 8:79438752-79438774 CCAGAATTAAAAATATCAGAAGA No data
Right 1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG No data
1043358188_1043358192 -6 Left 1043358188 8:79438751-79438773 CCCAGAATTAAAAATATCAGAAG No data
Right 1043358192 8:79438768-79438790 CAGAAGAAGGAGAACTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043358192 Original CRISPR CAGAAGAAGGAGAACTGGTC TGG Intergenic
No off target data available for this crispr