ID: 1043358492

View in Genome Browser
Species Human (GRCh38)
Location 8:79441543-79441565
Sequence GTGGTGGCCCTTAAAAAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043358478_1043358492 11 Left 1043358478 8:79441509-79441531 CCTGCCGCCTTCCTTCCCAAGTG No data
Right 1043358492 8:79441543-79441565 GTGGTGGCCCTTAAAAAGGGGGG No data
1043358484_1043358492 -4 Left 1043358484 8:79441524-79441546 CCCAAGTGGTCTAGAGCTGGTGG No data
Right 1043358492 8:79441543-79441565 GTGGTGGCCCTTAAAAAGGGGGG No data
1043358477_1043358492 12 Left 1043358477 8:79441508-79441530 CCCTGCCGCCTTCCTTCCCAAGT No data
Right 1043358492 8:79441543-79441565 GTGGTGGCCCTTAAAAAGGGGGG No data
1043358482_1043358492 0 Left 1043358482 8:79441520-79441542 CCTTCCCAAGTGGTCTAGAGCTG No data
Right 1043358492 8:79441543-79441565 GTGGTGGCCCTTAAAAAGGGGGG No data
1043358481_1043358492 4 Left 1043358481 8:79441516-79441538 CCTTCCTTCCCAAGTGGTCTAGA No data
Right 1043358492 8:79441543-79441565 GTGGTGGCCCTTAAAAAGGGGGG No data
1043358480_1043358492 7 Left 1043358480 8:79441513-79441535 CCGCCTTCCTTCCCAAGTGGTCT No data
Right 1043358492 8:79441543-79441565 GTGGTGGCCCTTAAAAAGGGGGG No data
1043358486_1043358492 -5 Left 1043358486 8:79441525-79441547 CCAAGTGGTCTAGAGCTGGTGGT No data
Right 1043358492 8:79441543-79441565 GTGGTGGCCCTTAAAAAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043358492 Original CRISPR GTGGTGGCCCTTAAAAAGGG GGG Intergenic
No off target data available for this crispr