ID: 1043364203

View in Genome Browser
Species Human (GRCh38)
Location 8:79513021-79513043
Sequence CAGGGGTTCTACGGCATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043364203_1043364214 0 Left 1043364203 8:79513021-79513043 CCCTGGATGCCGTAGAACCCCTG No data
Right 1043364214 8:79513044-79513066 GTTCCTGGAAGGGAGAGTTTGGG No data
1043364203_1043364213 -1 Left 1043364203 8:79513021-79513043 CCCTGGATGCCGTAGAACCCCTG No data
Right 1043364213 8:79513043-79513065 GGTTCCTGGAAGGGAGAGTTTGG No data
1043364203_1043364209 -10 Left 1043364203 8:79513021-79513043 CCCTGGATGCCGTAGAACCCCTG No data
Right 1043364209 8:79513034-79513056 AGAACCCCTGGTTCCTGGAAGGG No data
1043364203_1043364216 21 Left 1043364203 8:79513021-79513043 CCCTGGATGCCGTAGAACCCCTG No data
Right 1043364216 8:79513065-79513087 GGTGCAGCTGCTCGCTAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043364203 Original CRISPR CAGGGGTTCTACGGCATCCA GGG (reversed) Intergenic
No off target data available for this crispr