ID: 1043367157

View in Genome Browser
Species Human (GRCh38)
Location 8:79546130-79546152
Sequence TGTCCAGTGCTGAAAGTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043367157_1043367159 14 Left 1043367157 8:79546130-79546152 CCAGCTACTTTCAGCACTGGACA No data
Right 1043367159 8:79546167-79546189 AAAATCAACAAAGAAACATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043367157 Original CRISPR TGTCCAGTGCTGAAAGTAGC TGG (reversed) Intergenic
No off target data available for this crispr