ID: 1043373095

View in Genome Browser
Species Human (GRCh38)
Location 8:79615285-79615307
Sequence CTGTGAGCAATGAGCTACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 141}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043373095_1043373098 -5 Left 1043373095 8:79615285-79615307 CCTTGGTAGCTCATTGCTCACAG 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1043373098 8:79615303-79615325 CACAGGAGGCTGAAAAAAGCTGG No data
1043373095_1043373099 7 Left 1043373095 8:79615285-79615307 CCTTGGTAGCTCATTGCTCACAG 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1043373099 8:79615315-79615337 AAAAAAGCTGGCCTCCGAGCAGG No data
1043373095_1043373100 10 Left 1043373095 8:79615285-79615307 CCTTGGTAGCTCATTGCTCACAG 0: 1
1: 0
2: 0
3: 5
4: 141
Right 1043373100 8:79615318-79615340 AAAGCTGGCCTCCGAGCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043373095 Original CRISPR CTGTGAGCAATGAGCTACCA AGG (reversed) Intronic
901300541 1:8197126-8197148 CAGTGAGCCATGATCTGCCACGG - Intergenic
902125428 1:14206091-14206113 CTGTAAGTAATGAGTTATCAAGG + Intergenic
902398225 1:16143878-16143900 CTGGGAGCAAGAAGCCACCAGGG - Intronic
903456899 1:23493873-23493895 CTGTGCTCAAAAAGCTACCAGGG + Intergenic
904391701 1:30190273-30190295 GTGTAAGCAAAGAGCTCCCACGG + Intergenic
904429006 1:30450007-30450029 CTGTGAGCAGTGAGAGGCCAGGG - Intergenic
905453613 1:38072916-38072938 CTGTGAGCAGGGAGCAGCCATGG + Intergenic
906817981 1:48898947-48898969 CTGAGAGTAAGGAGGTACCATGG - Intronic
907753365 1:57285224-57285246 CTGTGAGTAAAGAGCTAGCTTGG - Intronic
912374280 1:109197805-109197827 CTGTGTGCAAAGTGCTCCCAGGG + Intronic
1063488155 10:6439161-6439183 GTGTGAGCCAGGAGCTCCCAAGG - Intronic
1068668582 10:59701423-59701445 CTGTGGGTAATGAGGAACCATGG - Intronic
1071292437 10:84197352-84197374 CTGGGAGCACTGAGACACCATGG + Intronic
1071399213 10:85253175-85253197 CTTTTAGAAATGAGCTACTAGGG + Intergenic
1073160456 10:101389545-101389567 CTGGGAGTAATGACCTAACAGGG - Intronic
1074306670 10:112285399-112285421 ATGAGAGCAAAGAGCTTCCAGGG + Intronic
1074774919 10:116760492-116760514 CTGGGAGCAAGGAGATTCCAGGG - Intergenic
1076701997 10:132278087-132278109 GTGTGAGCAATGGGTTCCCAGGG - Intronic
1076733112 10:132447952-132447974 CTGTGAGGCTTGATCTACCACGG - Exonic
1078492771 11:11784794-11784816 CTGTGACCAGTGAGATACCTTGG + Intergenic
1084801932 11:71549682-71549704 GTGGGAGCAATAAGCTATCAGGG - Intronic
1087736404 11:101839327-101839349 TTCTGAGCAATGAGCCTCCATGG + Intronic
1088229615 11:107660356-107660378 CGGTGAACACTGAGCTGCCAAGG + Intronic
1088598522 11:111456811-111456833 CTCTCAGGAATGAGCTCCCAGGG + Intronic
1092815447 12:12308781-12308803 CTGTGATCCAAGGGCTACCATGG - Intergenic
1096350953 12:50901155-50901177 CTGTGAGCAGTGAGCATCCTGGG + Intergenic
1096502158 12:52070594-52070616 CAGTGAGCAGTGAGCAAGCAGGG - Intronic
1098644343 12:72880121-72880143 GTGTGAGGAGTGAGCTCCCAAGG + Intergenic
1104420144 12:128628195-128628217 CTGTGAGGAAGGGGCTCCCAGGG - Intronic
1105264407 13:18803386-18803408 CTGTGAGAGCTGAGCTCCCAAGG + Intergenic
1105781689 13:23710834-23710856 TTGTCAGCACTTAGCTACCAAGG - Intergenic
1108407485 13:50119867-50119889 CTGTGAGCTCATAGCTACCACGG - Intronic
1112624743 13:101091285-101091307 TTTTGAGAAATGAGCTAGCAGGG - Intronic
1113022662 13:105905652-105905674 CTGTGTGTACTGATCTACCAAGG + Intergenic
1115953568 14:38749617-38749639 CTGTGTGAAATGAGAGACCATGG - Intergenic
1117665645 14:58053314-58053336 CTGTGAGCAATGGGGTGCCGTGG - Intronic
1118820565 14:69342750-69342772 CAGTGGGCAATAAGCTACGATGG + Intronic
1119853273 14:77881320-77881342 CTGGGAGAAGTGAGCTGCCACGG - Intronic
1202834038 14_GL000009v2_random:64683-64705 CTGTGAGGGCTGAGCTCCCAAGG - Intergenic
1131229815 15:90651649-90651671 CTGGGACCAATGGGCTACCCAGG - Intergenic
1133342476 16:5045589-5045611 CTGAGAGGCATGAGCTGCCAGGG - Intronic
1135933360 16:26758187-26758209 CTGTGAACAAAGAGATGCCAAGG + Intergenic
1140526471 16:75627144-75627166 CTGAGGGAAATGAGATACCATGG - Intergenic
1141963928 16:87428639-87428661 CTGTGAGCCATGCCCCACCATGG + Intronic
1144174419 17:12691288-12691310 CTGTGAAGAATGAGCGAGCATGG + Intronic
1148519880 17:48262804-48262826 GTGTGTGCAATGAAATACCAAGG - Intronic
1148539461 17:48468241-48468263 CTGTGATCAATAAGGTACCCTGG + Intergenic
1148841542 17:50501747-50501769 CTGGGAGCCATGAGCTAACTTGG + Intergenic
1150157367 17:62865433-62865455 CTGTAAGCAATGTGTTCCCATGG - Intergenic
1152267430 17:79304018-79304040 CTGTGAGAAATGGGCTCCCTGGG - Intronic
1153255568 18:3166994-3167016 CTGTTAGCTAGGAGCTAGCATGG + Intronic
1154423986 18:14258175-14258197 CTGTGAGGGCTGAGCTCCCAAGG - Intergenic
1158028483 18:52933075-52933097 TTTTGAGCAATGAGCTATTAAGG - Intronic
1158919474 18:62174272-62174294 CAGTGAACTAGGAGCTACCATGG - Intronic
1159589301 18:70315321-70315343 AAGTGATCAAGGAGCTACCATGG - Intronic
1168164009 19:54534168-54534190 CTGTGAGGAATCAGGTACCCAGG + Intronic
1202638642 1_KI270706v1_random:63009-63031 CTGTGAGGGCTGAGCTCCCAAGG + Intergenic
926422254 2:12711580-12711602 CACTGAGTAATGGGCTACCATGG + Intergenic
926547091 2:14255449-14255471 CTGTGAGCAGAGAGAGACCAGGG + Intergenic
929080338 2:38116255-38116277 CTGGGAGAAATCAGCTGCCATGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
937462729 2:122103361-122103383 CTGTGAGGAGTGGGCTCCCAAGG + Intergenic
940531752 2:154886632-154886654 GTGTCAGCAATGAGGTAGCATGG + Intergenic
941359206 2:164531190-164531212 CAGTGATCACTGAGCTACCAAGG + Intronic
942659227 2:178246465-178246487 GTGTGAGAACTGAGTTACCAGGG + Intronic
946545612 2:220739424-220739446 CTGTGATTCGTGAGCTACCAGGG + Intergenic
946890797 2:224274124-224274146 CTGTGAGACATGGGGTACCAAGG + Intergenic
947004955 2:225500378-225500400 TTGTGAAAAATGAACTACCAAGG - Intronic
1170542727 20:17405314-17405336 CTGTGATCAATGGGCTTCCCTGG - Intronic
1171885231 20:30647129-30647151 CTGTGAGGGCTGAGCTCCCAGGG + Intergenic
1174049725 20:47759214-47759236 CTGTGAGCCATGAGCAGCCAGGG - Intronic
1174389346 20:50208268-50208290 CTGTGAGCTCTGAGCTGCAATGG - Intergenic
1175744092 20:61441764-61441786 CTGTGAGCAATAAATTTCCATGG + Intronic
1175936204 20:62515245-62515267 CTGTGAACACTGAGCTGCCGAGG + Intergenic
1176140505 20:63542753-63542775 CCCAGAGCAATGAGCTCCCACGG - Intronic
1176849483 21:13901828-13901850 CTGTGAGGGCTGAGCTCCCAAGG + Intergenic
1180363325 22:11918879-11918901 CTGTGAGGGCTGAGCTCCCAAGG - Intergenic
1180990405 22:19932366-19932388 CTATGTGCAGTGAGCCACCATGG - Intronic
951023035 3:17801068-17801090 ATGTGAGCTATGTGGTACCATGG - Intronic
951634341 3:24756437-24756459 CTCCGAGCAATGAGATGCCATGG + Intergenic
954590232 3:51776595-51776617 CTGTGAGCAATGAGACTCAAGGG - Intergenic
959460839 3:106623544-106623566 CAGTGAGCACTGAGGTCCCATGG + Intergenic
962159305 3:132982007-132982029 CTGTGAGCATTGCCCTAGCAAGG + Intergenic
964163327 3:153671833-153671855 CAGTCAGCAATCAGCAACCAAGG + Intergenic
964178931 3:153859899-153859921 CAGTGAGTAGTGAGCTATCATGG - Intergenic
969141511 4:5078191-5078213 TTTTGACCAATGAGCTACAAGGG - Intronic
973368884 4:49229397-49229419 CTGTGAGGGCTGAGCTCCCAAGG + Intergenic
973392162 4:49566018-49566040 CTGTGAGGGCTGAGCTCCCAAGG - Intergenic
975017557 4:69441897-69441919 CTTTGAGCCAAGACCTACCATGG + Intergenic
977378380 4:96237772-96237794 GTGTGAGGAGTGAGCTCCCAAGG - Intergenic
980958661 4:139453748-139453770 CTGAGAGGAAGGAGGTACCACGG - Intronic
982752515 4:159179015-159179037 CTTTGTCCAATGTGCTACCATGG + Intronic
1202765980 4_GL000008v2_random:148868-148890 CTGTGAGGGCTGAGCTCCCAAGG + Intergenic
986866915 5:12000066-12000088 ATGTGAGCAATGAACTACAGTGG - Intergenic
992539347 5:77747670-77747692 TTATTAGCAATGAGCTAGCAAGG + Intronic
993100835 5:83537964-83537986 CTGTGATAAATCAGTTACCATGG - Exonic
993673684 5:90792802-90792824 CCTTGAGCCCTGAGCTACCATGG - Intronic
997368799 5:133342912-133342934 CCGTGAGCAATCAGAAACCAGGG - Intronic
999320733 5:150613542-150613564 CTGTGAGCAATGAGGAGCCATGG + Intronic
1000130660 5:158294788-158294810 CAGTTAGCACCGAGCTACCAAGG + Intergenic
1001605072 5:172953895-172953917 CTATGAGCAATGGACTTCCATGG + Intergenic
1003097668 6:3155461-3155483 CTGTGAGCCATGACCACCCATGG + Intronic
1003101352 6:3178768-3178790 CTGTGAGCCATGACCGCCCATGG + Intergenic
1005195147 6:23273940-23273962 CTTTCAGCGATGAGCTACTAAGG - Intergenic
1010541970 6:77102850-77102872 CTGGGAGCAATGAGGTCCTAAGG - Intergenic
1012614705 6:101262331-101262353 CTCTGAGGACTGTGCTACCAGGG - Intergenic
1013386237 6:109634554-109634576 TTGTGAGCTATGATCTTCCATGG + Intronic
1015892521 6:137982978-137983000 TTCTGCGCACTGAGCTACCACGG - Intergenic
1016152879 6:140765984-140766006 CTTTGAGCAATCAGCTTCAATGG + Intergenic
1018444564 6:163843397-163843419 TTGTGAGGAATGTGCTTCCATGG + Intergenic
1023767541 7:43525653-43525675 CTGAGATCACTGAGCTACCTTGG - Intronic
1025255001 7:57378840-57378862 CTTTGAGGAATGTGCTACCTGGG + Intergenic
1028882767 7:95898514-95898536 CTGTGAGCAAGTATCTACTAGGG - Intronic
1029222381 7:99000706-99000728 CTGTGAGCAATGGGCCAGCCTGG + Intronic
1030528549 7:110682804-110682826 CTGTGAGCACTGTGTTCCCATGG - Intronic
1030686104 7:112488537-112488559 TTGTGAGCAAAGAGGTATCAAGG - Intronic
1030750310 7:113224692-113224714 CTGGGAGCAAAGAGTTACCTAGG + Intergenic
1031920252 7:127595153-127595175 CTGACAGCAAGGAGATACCAGGG + Intronic
1032492227 7:132332251-132332273 CTTTGGGCAATGCACTACCAGGG + Intronic
1033938500 7:146620295-146620317 CCGTTAGCCATGAGCTTCCATGG - Intronic
1034257412 7:149732263-149732285 CTGTGAGCTCTGAGCTGCCTGGG + Intronic
1034452884 7:151146992-151147014 CTGGGAGAAATGAGCTGCCAAGG + Intergenic
1036635363 8:10546806-10546828 CTGTGTGCAATCAGCTACTCAGG - Intronic
1037935356 8:22911847-22911869 CTGTGTGCGCTGATCTACCAAGG - Intronic
1043096593 8:75983016-75983038 CTTTCAGAAATGAGTTACCATGG - Intergenic
1043126760 8:76406123-76406145 TTGTGAGTAAAGAGCTACCTTGG - Intergenic
1043373095 8:79615285-79615307 CTGTGAGCAATGAGCTACCAAGG - Intronic
1045754726 8:105529222-105529244 CTGTGAGCAATAATCTAATAAGG - Intronic
1049071460 8:140358878-140358900 CTGGGAGCAGTGAGCACCCAGGG + Intronic
1049837908 8:144750779-144750801 TTGTGAGCAATAATCTCCCAGGG - Intronic
1055877859 9:80965026-80965048 CTGTGAGCAAAAAGCTATTAAGG - Intergenic
1058368519 9:104236522-104236544 CTGTGAACACTGAGTTAGCAGGG - Intergenic
1058618869 9:106862981-106863003 CTCTGAATAATGAGCAACCAGGG - Intergenic
1059259811 9:112964767-112964789 CTGTGATCACTGAGATAGCAAGG + Intergenic
1062316583 9:135970312-135970334 ATGTGTGCAGTGAGCTGCCACGG - Intergenic
1203546732 Un_KI270743v1:133757-133779 CTGTGAGGGCTGAGCTCCCAAGG + Intergenic
1185956261 X:4494261-4494283 CTGTGATCAAGGAGCAACTAGGG + Intergenic
1187280824 X:17857600-17857622 TTGTCAGCATGGAGCTACCAAGG + Intronic
1187817690 X:23250606-23250628 CTGGGATCAGTGAGCTACCGGGG + Intergenic
1188460361 X:30418994-30419016 CTGTGAGTATTGAGTGACCAAGG - Intergenic
1188530125 X:31130923-31130945 CTGTGGGCAATTATCTAGCAGGG + Intronic
1188799210 X:34506151-34506173 CTGGGAGATATGAGCCACCAAGG - Intergenic
1193706046 X:84821573-84821595 CTGTGAACAATGAGTTACAGTGG + Intergenic
1194713832 X:97267964-97267986 CTGAGAGCAGTGAGCCAACAGGG - Intronic
1195613555 X:106895187-106895209 CTGTGGGCACAGGGCTACCAGGG - Intronic
1199506279 X:148564843-148564865 CTGTGTGGAATGTGCTACCTAGG - Intronic
1201387059 Y:13452632-13452654 CTGTGTGCATTGTGCCACCAAGG - Intronic