ID: 1043373509

View in Genome Browser
Species Human (GRCh38)
Location 8:79621103-79621125
Sequence CATGGAAGGAAGAGCCCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043373502_1043373509 5 Left 1043373502 8:79621075-79621097 CCCTTCTCCACCAGTGCTGCTGG 0: 1
1: 1
2: 2
3: 23
4: 297
Right 1043373509 8:79621103-79621125 CATGGAAGGAAGAGCCCAGAAGG No data
1043373506_1043373509 -5 Left 1043373506 8:79621085-79621107 CCAGTGCTGCTGGTGCTGCATGG 0: 1
1: 0
2: 3
3: 37
4: 354
Right 1043373509 8:79621103-79621125 CATGGAAGGAAGAGCCCAGAAGG No data
1043373500_1043373509 18 Left 1043373500 8:79621062-79621084 CCCATCAGCTCTGCCCTTCTCCA 0: 1
1: 1
2: 4
3: 36
4: 425
Right 1043373509 8:79621103-79621125 CATGGAAGGAAGAGCCCAGAAGG No data
1043373501_1043373509 17 Left 1043373501 8:79621063-79621085 CCATCAGCTCTGCCCTTCTCCAC 0: 1
1: 1
2: 4
3: 79
4: 674
Right 1043373509 8:79621103-79621125 CATGGAAGGAAGAGCCCAGAAGG No data
1043373499_1043373509 19 Left 1043373499 8:79621061-79621083 CCCCATCAGCTCTGCCCTTCTCC 0: 1
1: 0
2: 2
3: 61
4: 663
Right 1043373509 8:79621103-79621125 CATGGAAGGAAGAGCCCAGAAGG No data
1043373504_1043373509 4 Left 1043373504 8:79621076-79621098 CCTTCTCCACCAGTGCTGCTGGT 0: 1
1: 1
2: 2
3: 24
4: 299
Right 1043373509 8:79621103-79621125 CATGGAAGGAAGAGCCCAGAAGG No data
1043373505_1043373509 -2 Left 1043373505 8:79621082-79621104 CCACCAGTGCTGCTGGTGCTGCA 0: 1
1: 0
2: 4
3: 49
4: 462
Right 1043373509 8:79621103-79621125 CATGGAAGGAAGAGCCCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043373509 Original CRISPR CATGGAAGGAAGAGCCCAGA AGG Intronic
No off target data available for this crispr