ID: 1043375815

View in Genome Browser
Species Human (GRCh38)
Location 8:79648217-79648239
Sequence CTCATTTTACAGATTGACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 1, 3: 45, 4: 345}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043375815_1043375816 -3 Left 1043375815 8:79648217-79648239 CCTTTGTCAATCTGTAAAATGAG 0: 1
1: 0
2: 1
3: 45
4: 345
Right 1043375816 8:79648237-79648259 GAGACTAGTAATAGAACTTATGG No data
1043375815_1043375817 15 Left 1043375815 8:79648217-79648239 CCTTTGTCAATCTGTAAAATGAG 0: 1
1: 0
2: 1
3: 45
4: 345
Right 1043375817 8:79648255-79648277 TATGGAGTTAGTGTGAGAATTGG No data
1043375815_1043375818 19 Left 1043375815 8:79648217-79648239 CCTTTGTCAATCTGTAAAATGAG 0: 1
1: 0
2: 1
3: 45
4: 345
Right 1043375818 8:79648259-79648281 GAGTTAGTGTGAGAATTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043375815 Original CRISPR CTCATTTTACAGATTGACAA AGG (reversed) Intronic
901798631 1:11694411-11694433 CTCATTTTCCAGAGTGATACAGG - Intronic
902419324 1:16265566-16265588 CTCATTTTACAGATGAATAATGG + Intronic
902497409 1:16883177-16883199 TTCATTATACAGCTGGACAATGG + Intronic
902533188 1:17103529-17103551 CCCATTTTACAGATAGACCAAGG + Intronic
902607725 1:17578118-17578140 CCCATTTTACAGAAGGAAAAAGG - Intronic
903134375 1:21299828-21299850 CCCATTTTACAGATGAAAAATGG - Intronic
903875467 1:26470760-26470782 TACATTTTACAGCTTTACAATGG + Exonic
904416704 1:30366265-30366287 ATCATTTTACAGAATGGGAATGG - Intergenic
904751689 1:32744566-32744588 CTCACTTTACAGATGGGAAATGG + Intronic
907625308 1:56023753-56023775 CTCATTTCACAGTTAGAAAATGG + Intergenic
908034419 1:60036591-60036613 CCCATTTTACAGTTGGAGAATGG + Intronic
908439348 1:64137962-64137984 CTCATTTCACAGATGAAGAAGGG - Intronic
908536205 1:65080039-65080061 CTCATTTTACAGTTGAAGAAAGG - Intergenic
910303150 1:85730682-85730704 CTTATTTTACAGATTCAAGATGG - Exonic
910625442 1:89302292-89302314 CCCATTTTACAGAGAGCCAATGG + Intergenic
910930596 1:92439459-92439481 CTCATTCTGCAGGTTCACAAAGG + Intergenic
911630917 1:100182543-100182565 CTCAATTTAAAAATTGGCAAAGG - Intergenic
911953524 1:104207955-104207977 CACATTTTACAGATTTACAGAGG + Intergenic
912024687 1:105154085-105154107 CTCAATTTAAAAATTGTCAAAGG - Intergenic
912026471 1:105180882-105180904 TTCATTTTACAAATTGACACGGG - Intergenic
912391429 1:109305941-109305963 ACCATTTTACAGAGTGAAAATGG + Intronic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912865102 1:113249521-113249543 CCCATTTTACAGAATGTCAAAGG + Intergenic
912944568 1:114074442-114074464 CTAATTTTACAAATGAACAAAGG + Intergenic
913657757 1:120977489-120977511 TTCATTATACAGCTGGACAATGG - Intergenic
913694130 1:121307849-121307871 GTCATTTTACAGAGTGACTGGGG + Intronic
914009106 1:143760573-143760595 TTCATTTTACAGCTGGACAATGG - Intergenic
914143433 1:144972217-144972239 GTCATTTTACAGAGTGACTGGGG - Intronic
914647736 1:149669225-149669247 TTCATTATACAGCTGGACAATGG - Intergenic
915475786 1:156152130-156152152 CCCATTTTACAGATCAAGAAGGG - Intronic
916802469 1:168227282-168227304 CTCATTTCACAGATGGGGAACGG - Intronic
916972719 1:170041830-170041852 CCCTTTTTACAGATTGGGAAGGG - Intronic
918132513 1:181642197-181642219 CTCATTTTACAGAAGAACCAAGG - Intronic
918289854 1:183096759-183096781 GGCATTTGACCGATTGACAAGGG + Intronic
919508374 1:198429199-198429221 TTCATTTTACAGATGAACCAGGG + Intergenic
920022111 1:202964173-202964195 TTCCTTTTACAGAGAGACAATGG - Intronic
920481457 1:206326236-206326258 GTCATTTTACAGAGTGACTGGGG + Intronic
921240326 1:213174266-213174288 CCCATTTTACAGATGAATAAAGG - Intronic
921969572 1:221133232-221133254 CTTATTTTACAGATTTATTATGG + Intergenic
922433402 1:225579076-225579098 CCCATTTTACAGATAGGAAATGG + Intronic
923943651 1:238858218-238858240 CTTAATTTACAGATTGACACTGG - Intergenic
1063005628 10:1967981-1968003 CTCATTTTATAAATGGAGAAAGG + Intergenic
1063168573 10:3485780-3485802 CTCAATTAACAGTTTGACCAAGG - Intergenic
1063811749 10:9718609-9718631 CTCAGTTCACATATTTACAATGG + Intergenic
1064727555 10:18296928-18296950 CTCATTTTACAGATGAATGACGG - Intronic
1065364190 10:24918808-24918830 ATCATTTTACAAATGAACAAAGG + Intronic
1065873762 10:29979514-29979536 CTAATTTGAAAGTTTGACAAAGG + Intergenic
1067522697 10:47020247-47020269 CTCATTTCAAAGATGGACATGGG + Intergenic
1068150824 10:53128414-53128436 TTCACTTTAAGGATTGACAAAGG - Intergenic
1069828423 10:71268284-71268306 CCCATTTCACAGATTGGCAAAGG + Intronic
1070443818 10:76474543-76474565 CTCATTTTAAAAATGGTCAAAGG + Intronic
1070658574 10:78288713-78288735 CCCATTTTACAGATGGGGAAGGG - Intergenic
1070688734 10:78509275-78509297 CCCATTTCACAGATGGACAAGGG + Intergenic
1070780755 10:79136195-79136217 CTCATTTTACAGATAAGAAAAGG - Intronic
1071134151 10:82434198-82434220 CTCTTTTTAGAGATTGTGAATGG + Intronic
1071586132 10:86823369-86823391 CTCATTTTACAGATTGGGTACGG + Intronic
1072006119 10:91249645-91249667 TCCATTTTACAGATTAAAAAAGG - Intronic
1072315219 10:94196053-94196075 CTCATTTGACAGGCTGGCAAAGG - Intronic
1073322941 10:102626611-102626633 CTCATTTTACAGATGACAAAGGG - Intronic
1073732381 10:106305268-106305290 CTCATTTTATTTATTGACCATGG - Intergenic
1074208126 10:111302129-111302151 TACATTTTCCAGATTCACAAGGG - Intergenic
1075926634 10:126256415-126256437 CCCATTTTACAGATGGAGACTGG - Intronic
1078265038 11:9748919-9748941 CCCATTGTACAGAGTGAAAACGG - Intronic
1078402356 11:11039362-11039384 CTCATTTTACCAGGTGACAATGG + Intergenic
1079314324 11:19395002-19395024 CCCATTTCACAGACTGAAAAAGG - Intronic
1080131987 11:28806614-28806636 CTCAATTTAAAGGTTGACAATGG + Intergenic
1080161499 11:29182009-29182031 ATCATTGTAGAAATTGACAAAGG - Intergenic
1080840364 11:35978117-35978139 ATCTTCTTACTGATTGACAATGG + Intronic
1081885774 11:46494754-46494776 CTTCTTTTACAGACTGTCAATGG + Intronic
1082054023 11:47797978-47798000 CTCATTATGCAGATTCACATAGG + Exonic
1082207911 11:49460867-49460889 TTCATTTTAAGGTTTGACAAGGG - Intergenic
1083566153 11:63718142-63718164 CTCATTTTTCAGATTCAGGAAGG + Intronic
1084508982 11:69590931-69590953 ATTATTTTACAGCTAGACAATGG + Intergenic
1086299110 11:85405638-85405660 CCCATTTTACAGATTAGAAAGGG + Intronic
1086915055 11:92520568-92520590 CTCACTTTTAAGATTGACCAAGG - Intronic
1087361390 11:97164681-97164703 CTCATTCTAGAAATTGACACTGG + Intergenic
1087529792 11:99365201-99365223 CTCATTTTAAAGATGGGAAAAGG - Intronic
1088262750 11:107959840-107959862 CTCAGTTTCCAGTTTGTCAATGG - Intronic
1088418471 11:109616515-109616537 CTCATTTTAAAAATGGGCAAAGG + Intergenic
1088906603 11:114159855-114159877 CCCATTTTACAGATGACCAAGGG + Intronic
1089568112 11:119383105-119383127 TTCATTTTACAGATGGATATTGG + Intergenic
1090646550 11:128771105-128771127 CCCATTTTACAGATGCAAAATGG - Intronic
1090998351 11:131886968-131886990 CTCATTTTACACCTTGTCTAAGG + Intronic
1091054459 11:132405323-132405345 CTCATTTTTCACATTCTCAATGG - Intergenic
1091128870 11:133127255-133127277 ATCATTTGACAGATATACAAAGG - Intronic
1091871886 12:3898826-3898848 CTCATTTGACAGCTTTTCAAGGG - Intergenic
1091949310 12:4580016-4580038 CTCATTTTACAGATGGAGAAAGG - Intronic
1092516632 12:9221487-9221509 CTCTTTATACAATTTGACAAAGG + Intergenic
1093767062 12:22976521-22976543 TTCATTTTACAGATAGCCAAGGG + Intergenic
1093985624 12:25529038-25529060 CTCAATTTACCGATTGTGAAGGG - Intronic
1095284812 12:40396919-40396941 ATCATTTTCCAGATCTACAATGG - Intronic
1095934241 12:47659513-47659535 CACATTTAACAGATTGGAAAAGG - Intergenic
1096525952 12:52210542-52210564 CTTATTTTATAGATTGAAAAAGG - Intergenic
1096536079 12:52275691-52275713 CCCATTTCACAGATGGAGAAAGG + Intronic
1096583056 12:52600890-52600912 CCCATTTTACAAATGGAAAAGGG + Intronic
1096854587 12:54470993-54471015 CTCATTTAATAGTTTAACAAAGG + Intronic
1096906512 12:54941650-54941672 CTCAGTTTACCCATTGAGAATGG + Intergenic
1097064357 12:56309820-56309842 CTTATAGTCCAGATTGACAATGG + Intronic
1097476660 12:60065818-60065840 TTTTTTTTACAGTTTGACAATGG - Intergenic
1097478783 12:60094164-60094186 TAGATTATACAGATTGACAAAGG + Intergenic
1098575454 12:72036854-72036876 CTTAGTTTACAGGTTGAGAAAGG + Intronic
1098954103 12:76670690-76670712 CTCATTTTACATATGGACAGAGG - Intergenic
1100014692 12:89994957-89994979 CCCATTTTACAGATAAACAAAGG - Intergenic
1100957585 12:99926067-99926089 CCCATTTTATAGAATGATAAAGG + Intronic
1101530114 12:105566108-105566130 CTCTTGATATAGATTGACAATGG + Intergenic
1102898019 12:116614090-116614112 CGCATTTTACAGATGATCAATGG - Intergenic
1104424710 12:128666536-128666558 CTCATTTTACAAATTAGCAGGGG - Intronic
1105634294 13:22202485-22202507 CTCATTTTACAGAGAGGAAAAGG + Intergenic
1106532223 13:30604109-30604131 CTCTTTGTGCAGATTGAAAAGGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1108149926 13:47522723-47522745 CACAGTTTAAAGATTGAAAAGGG + Intergenic
1108666285 13:52634831-52634853 CTCATTTTACAGTTGGGGAAAGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1110077194 13:71261459-71261481 CTTATTTTACAGAGTCCCAATGG - Intergenic
1112752170 13:102594608-102594630 TTCATTTTACAGCTGTACAAAGG + Intergenic
1113218738 13:108073726-108073748 CTCATTTAACAGGATGAAAAGGG + Intergenic
1116910127 14:50453075-50453097 CTCATTCTCCAGACTGACTAAGG - Intronic
1117075596 14:52100405-52100427 CTGATTTTACATATTCAAAATGG - Intergenic
1117087356 14:52215272-52215294 TTCAGTTTTCAGATAGACAAGGG + Intergenic
1118680223 14:68233720-68233742 AACATTTTCCAGTTTGACAAGGG + Intronic
1119654943 14:76410553-76410575 CCCATTTTACAGATGGAGAATGG + Intronic
1123175496 14:106413808-106413830 CCCCTGTGACAGATTGACAAGGG - Intergenic
1124056758 15:26247457-26247479 CTCAATTTAAAAATTAACAAAGG - Intergenic
1125070143 15:35545277-35545299 CTCAGTTTATAGATTGAGTATGG + Intronic
1127671966 15:61203902-61203924 CTCATTCTCCACATTGTCAACGG - Intronic
1128411811 15:67406782-67406804 CTCTCTTTACAGATAGAGAAAGG - Intronic
1128436030 15:67649211-67649233 CTCATTTAAAAAATAGACAAAGG - Intronic
1128869127 15:71138981-71139003 CCCATTTTACAGATGAAGAAAGG + Intronic
1129236748 15:74228318-74228340 CTCATTTTACAGATGAGGAAAGG - Intergenic
1130175600 15:81565979-81566001 CACATTTTACAGATAAAGAAAGG + Intergenic
1130691755 15:86087673-86087695 CTCATTTTAAAGCTTTAAAATGG + Intergenic
1130735716 15:86546492-86546514 CTCATTTTACAGATGGCAGAAGG - Intronic
1130759782 15:86806619-86806641 CCCATTTTACAGATTAGGAAGGG - Intronic
1131697740 15:94897647-94897669 GTCATTTTTCAGGTTGAGAAAGG + Intergenic
1131786140 15:95912977-95912999 CCCATTTTATAGATTGTGAAAGG - Intergenic
1133360655 16:5171166-5171188 CCCATTGTATAGATTTACAAAGG + Intergenic
1135940816 16:26820117-26820139 CTCCTTTTACAGATGGGGAAAGG - Intergenic
1137853692 16:51772145-51772167 CTCCTTTTACAAATTCAAAACGG + Intergenic
1138293652 16:55868859-55868881 CTCATTTCACAGCTGGAAAATGG - Intronic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1140259451 16:73364919-73364941 CTCATTCTACAGGTGGACCATGG - Intergenic
1140972222 16:80024408-80024430 AACATTTTACAGATGGATAAAGG + Intergenic
1141229947 16:82157284-82157306 TTCATTTTACAGATACACCACGG - Intronic
1141312118 16:82924666-82924688 CTCACATTCCAGATTGATAACGG - Intronic
1144182157 17:12762553-12762575 CTCAGGTTACAGAATGAGAAGGG + Intronic
1146032146 17:29375446-29375468 CTCATTTTACAGATGGGGAAAGG + Intergenic
1148575068 17:48704708-48704730 TTCATTTGCCAGATGGACAAAGG + Intergenic
1150337800 17:64343097-64343119 CTCCTTTTACAGATGGGGAAAGG + Intronic
1150355438 17:64480474-64480496 CCCATTTTAGAGATTGAAGAGGG - Intronic
1150536221 17:66044956-66044978 CTCAATTTAAAAATAGACAAAGG + Intronic
1151287948 17:73127013-73127035 CTCAATTTTCTGATTGACAGAGG - Intergenic
1152049889 17:77965139-77965161 CCCATTTTACAGATGAGCAAAGG + Intergenic
1152700814 17:81818065-81818087 CTCATTTTACAGAAGTACAGGGG + Intergenic
1153897075 18:9574140-9574162 CCCATTATACAGAGTCACAAAGG - Intronic
1154090618 18:11357572-11357594 CTCAATTTATAAATTGGCAATGG + Intergenic
1155456457 18:26020403-26020425 CTCATTTTATACATTGACTAGGG - Intronic
1155824065 18:30416898-30416920 CTCATGATACAGAATGAAAATGG + Intergenic
1156530851 18:37813711-37813733 CTGATTCTCCAGCTTGACAATGG + Intergenic
1156885114 18:42126311-42126333 CTCATTTTACATATGGAAACAGG + Intergenic
1157147595 18:45180274-45180296 CTCATTTTACAGATGAACAGAGG - Intergenic
1158673865 18:59500986-59501008 CCCAGTTTACAGGTGGACAAAGG + Intronic
1158699772 18:59735479-59735501 CTCATCTGAGAGATTGGCAAGGG + Intergenic
1158776327 18:60585132-60585154 TTTATTTTCCAGATAGACAATGG + Intergenic
1159255293 18:65937297-65937319 TTCTTTTTACAGATTGACTGTGG - Intergenic
1162883995 19:13682589-13682611 CTCATTTAATAGGTTGACACTGG - Intergenic
1163168246 19:15512199-15512221 CCCATTTCACAGATTGGCAAAGG + Intronic
1166164660 19:40978872-40978894 CTCATTTTACAGATGAGAAACGG + Intergenic
1166562279 19:43740926-43740948 CTGATTTTACAGATTTCAAAAGG - Intronic
1167849664 19:52191615-52191637 CACTTGTTACTGATTGACAAGGG + Intronic
925083424 2:1088678-1088700 TTCATATTACAGTTTGACTATGG - Intronic
925215318 2:2089639-2089661 CTCATTATACAGATGGACGGAGG + Intronic
925494619 2:4432803-4432825 TTCATTTTTCACATTGGCAATGG + Intergenic
926766392 2:16326006-16326028 CTCATTTTACAGATGAAAAGTGG + Intergenic
927283353 2:21331086-21331108 CTGATTTTACAAATAGAGAATGG + Intergenic
927393727 2:22625508-22625530 CCCATTTTACAGAAGGAAAATGG + Intergenic
927656016 2:24947065-24947087 CTCATTTTACAAACTCCCAAAGG + Exonic
928002041 2:27532149-27532171 CTCATTTTACATATTGTCTACGG - Intergenic
928036448 2:27828618-27828640 CTGATTTTACAGATTGTAATTGG - Intronic
928112211 2:28519744-28519766 CACAATTTCCAGATTGCCAATGG - Exonic
929514538 2:42594562-42594584 CTAATCTTACAGATTAAAAATGG + Intronic
929521591 2:42657526-42657548 TTCATTTTTCTGATTGCCAAGGG + Intronic
929619316 2:43338464-43338486 TTAATTTTACAGAATGAAAAGGG - Intronic
930408473 2:50993252-50993274 TTCATTTTACAAAATGAGAATGG + Intronic
930698710 2:54438188-54438210 ATCATTTTACAGATGAGCAAAGG + Intergenic
932031577 2:68191858-68191880 GTCATTTTATAGATAGAAAATGG - Intronic
932275959 2:70452503-70452525 CTCCTTTTACAGATGAAAAAGGG + Intronic
933678964 2:85081805-85081827 CTCATCTGAAAGCTTGACAAAGG + Intergenic
937689216 2:124735779-124735801 CTCATCTTACAGATAAAAAATGG - Intronic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937845153 2:126571541-126571563 CTCATTTTACAGATGAAGCACGG + Intergenic
938420226 2:131139827-131139849 ATCATTTTACAGATGGGCAAAGG + Intronic
939477800 2:142708676-142708698 CTCATTTTCCTGATTAAAAATGG + Intergenic
939538155 2:143459112-143459134 CACATTTAATAGATTAACAAGGG + Intronic
940142972 2:150514594-150514616 CTCAGTTTACAGTATGTCAAAGG - Intronic
940925847 2:159362897-159362919 CTCATATTACAGATAAACAGTGG - Intronic
940963238 2:159809273-159809295 GTCATTTTACAGTTTGACTATGG + Intronic
940977872 2:159966626-159966648 CTCATTTCTCAAATTAACAATGG + Intronic
941946192 2:171100483-171100505 CTCATGTTACAGAAGGTCAAAGG - Intronic
941950803 2:171154376-171154398 CTCATTTTACAGATGAAAAGAGG + Intronic
942379439 2:175373332-175373354 CTGATTACACAGATTGACTAAGG - Intergenic
942596739 2:177598809-177598831 CTCTTTTCACAGATGGAAAAAGG + Intergenic
943321149 2:186444559-186444581 GTCATTTAACAGCTTGACTAGGG - Intergenic
943417422 2:187625859-187625881 CTCATTTTTCAGATAGGAAATGG + Intergenic
944782730 2:203036535-203036557 CTCATTTTACAGGTTAGAAAAGG - Intronic
945402672 2:209405279-209405301 CTGGTTTTAAAGATTGATAAAGG + Intergenic
946022984 2:216654396-216654418 GTCCTTTTACAGATGAACAATGG + Intronic
947913353 2:233816942-233816964 CTCATCTTCCAGATAGACACAGG - Intronic
947914844 2:233824442-233824464 CTCATTTTGAAGATTTACAGAGG - Intronic
1169334541 20:4744916-4744938 CTGATTTTAAAAATTGGCAAAGG + Intergenic
1170110254 20:12797235-12797257 CTCATTTCAGAGATTGACATGGG + Intergenic
1171378346 20:24711477-24711499 CTCATTTTAAAAATGGGCAAAGG - Intergenic
1172804194 20:37599424-37599446 CCCATTTTACAAATGGAAAAGGG - Intergenic
1173862207 20:46291437-46291459 CCCGTTTTACAGATTGGAAATGG + Intronic
1174748904 20:53092279-53092301 CTCAGTTTACACATTAAAAAAGG - Intronic
1175157575 20:56982293-56982315 CCCATTTTACAGACTTACAGAGG + Intergenic
1177068794 21:16474962-16474984 CTTATTTTACAGATGCATAAAGG - Intergenic
1177313037 21:19422201-19422223 CTAATTTTAGATATTGAAAAGGG - Intergenic
1177574692 21:22937326-22937348 CTCTTTTAATATATTGACAATGG + Intergenic
1178585434 21:33867223-33867245 CTCATTTCAGAGATTGGCAATGG + Exonic
1182088129 22:27575429-27575451 CTCATTTTCCAGACAGACAAAGG - Intergenic
1182481380 22:30611196-30611218 TTCATTCTATAGATGGACAAAGG - Intronic
1183340561 22:37278387-37278409 CTCATCTTACAGATGGGAAACGG - Intergenic
1185195698 22:49467963-49467985 CTCATTTTCCCGATTGACCATGG - Intronic
949187099 3:1205119-1205141 CTGATTTTAAAGATAGAGAAAGG + Intronic
950165404 3:10793523-10793545 CCCATTTTACAGATGGGAAATGG + Intergenic
950256043 3:11506931-11506953 ATCACTTTACAGAGTGACAAAGG + Intronic
951698241 3:25468152-25468174 TTCATTTTACAGATAGGCTAAGG - Intronic
952363066 3:32650375-32650397 CCCAATTTAAAAATTGACAAAGG - Intergenic
952374972 3:32759405-32759427 CTCATTTTAAACATTGATAATGG - Intronic
952713883 3:36458623-36458645 CTCATTTTACCGATAAACTAGGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953415188 3:42711727-42711749 CTCATTTTACGGATGGGCCAGGG + Intronic
953950557 3:47186345-47186367 TTCAGTTTATAGATTGACAGAGG + Intergenic
954477686 3:50763857-50763879 CTCAGTTTTCAAATTGACTATGG + Intronic
954937490 3:54340024-54340046 CTCACTTTTCAGGATGACAAAGG + Intronic
955079396 3:55644181-55644203 CTCATTTTACAGATGGTAAAAGG - Intronic
955121191 3:56060352-56060374 CCCATTTTACAGATGGGAAAAGG - Intronic
956131723 3:66060455-66060477 TTCATTTTAAAGTTTGGCAAAGG - Intergenic
956230916 3:67015821-67015843 CTATTTTTACAAACTGACAAGGG + Intergenic
957937353 3:86962089-86962111 CTCAGTTTAAAGACTGATAAAGG + Intronic
959148540 3:102579841-102579863 CTCATTTTATAGATAAAAAAGGG - Intergenic
959272827 3:104235533-104235555 CTCATTTTAAACATTTGCAAAGG + Intergenic
959554690 3:107703142-107703164 TTCAGTTTACAAATTCACAAAGG - Intronic
963095329 3:141532553-141532575 CTCATTTTACAGATGAACTTAGG - Intronic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
963737790 3:149039725-149039747 CTAATTTTACTGATTTAAAATGG - Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964844179 3:161027962-161027984 CTCATTTTATAGATAAACCAAGG + Intronic
965522880 3:169685935-169685957 CTCATTTTACTGATTAGGAAAGG + Intergenic
966399802 3:179536770-179536792 CTCATTTAACTGGTTGACCAAGG + Intergenic
969075423 4:4574398-4574420 CTCATTTGACAGTTTTATAAGGG + Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
971588823 4:28440696-28440718 GGCATTTTACATATTGACTAGGG - Intergenic
972280007 4:37592721-37592743 CTCACTTTACAGATGGGTAAAGG - Intronic
973244649 4:47998129-47998151 CTCATGTCACAGATTAAAAATGG - Intronic
973974673 4:56250720-56250742 CACGTTTTACAGATAGAAAATGG - Intronic
974661101 4:64889683-64889705 CTCATTTTACAGAATCACTGGGG + Intergenic
974827937 4:67153047-67153069 CTCATCTTGCAGATGGACAGAGG - Intergenic
975175045 4:71278767-71278789 CTCATTTTTTAAATGGACAAAGG - Intronic
976276311 4:83282732-83282754 TTCATTTTACAGATGAAAAACGG + Intronic
976712657 4:88088818-88088840 CTCATTTTACAGATGCATAAAGG + Intergenic
976907325 4:90255522-90255544 CTTAGTTTACAGTTTGACAATGG + Intronic
976938452 4:90669053-90669075 TTCATATTTCAGATAGACAATGG + Intronic
977889793 4:102296581-102296603 CTCATTTAACAGATGAGCAAAGG + Intronic
978130404 4:105189160-105189182 CCCATTTTACAGAGTAAGAAGGG - Intronic
978995076 4:115140599-115140621 CTCATTTTACAGTTTATAAAGGG + Intergenic
979300735 4:119084069-119084091 CTCATTTTACAGAAAGGAAATGG + Intergenic
981865175 4:149409074-149409096 CTTATTTTCCAGAATGACATGGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
982828854 4:160034154-160034176 CTTATTTTACAGATTATAAACGG + Intergenic
982838194 4:160150266-160150288 CTCACTTGACAGACTGAAAAAGG + Intergenic
983302274 4:165942033-165942055 CCCATTTTACAGATGGAAATGGG + Intronic
984180633 4:176478608-176478630 CTCAAATTAAAGATAGACAATGG + Intergenic
984432088 4:179662728-179662750 CTCATGTTACAGAGTGTTAAAGG + Intergenic
984783689 4:183549189-183549211 CTCATTTTAAAGATAGGCAAAGG - Intergenic
984842458 4:184080886-184080908 CACATTCTCCATATTGACAAAGG - Intergenic
985608032 5:869188-869210 CTCATTTTCCAGGTTGACTTTGG - Intronic
986028814 5:3876022-3876044 TTCATTTTATTGATTGATAAAGG - Intergenic
987295578 5:16547634-16547656 CTCATTGTACACATTGAAAGGGG - Intronic
987304119 5:16621761-16621783 CTCATTCTAGAGAATGACAAGGG - Intergenic
987967316 5:24893356-24893378 CTCATCTCACAGCTTCACAAAGG + Intergenic
988123607 5:26999591-26999613 CTCATTTGACAAAGGGACAAAGG + Intronic
990118343 5:52417235-52417257 CTTAGTTCACAGATTCACAATGG + Intergenic
990278321 5:54223479-54223501 GTCATTTTAGAGATAGAAAAGGG + Intronic
991511206 5:67378278-67378300 CTCATTTTTCAGTTTGTCTATGG + Intergenic
992356510 5:75990069-75990091 TTCATTCTACAGAATGACATAGG + Intergenic
992377490 5:76202615-76202637 CTCATTTTACATATTGGGGAAGG - Intronic
993220129 5:85084512-85084534 CTCACTTTAAACATTGAAAATGG - Intergenic
995860304 5:116634150-116634172 CTTATTTTGCACATTGAAAAAGG + Intergenic
996035986 5:118759385-118759407 CACATTTAACAGATTGGCAGAGG - Intergenic
997119611 5:131160674-131160696 TCCATTGTACAGATGGACAATGG + Intronic
997497718 5:134344458-134344480 CTCATTTTAAAAATAGGCAAAGG + Intronic
998203248 5:140141992-140142014 CTCTTTTTACATATAGAAAAAGG + Intergenic
998940315 5:147274765-147274787 CTCATTTTATAGATGCAGAAAGG + Intronic
999351850 5:150879329-150879351 CTAATTTTTCTGATTGACACTGG - Intronic
999611446 5:153374473-153374495 CTGATTTATCAGATTGATAATGG + Intergenic
1001547204 5:172577882-172577904 CTCACTTTACAGATGGGAAACGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003206466 6:4017376-4017398 CTCATTTTACACAGTAACATGGG - Intergenic
1004535669 6:16498823-16498845 CCCAGTTTAAAGATGGACAAAGG - Intronic
1004861182 6:19805849-19805871 CTCATCTTCCAGATTTAAAAAGG - Intergenic
1006725871 6:36198323-36198345 CTCATTTTACTGATGGAGTATGG + Intronic
1008628811 6:53344598-53344620 CCCATTTTACAGGTGGAAAAAGG - Intronic
1009038204 6:58143817-58143839 CTCAATTAAAAAATTGACAAGGG - Intergenic
1009281129 6:61753322-61753344 CTCAGTTTTCAAACTGACAAAGG + Intronic
1009602384 6:65818862-65818884 CTCATTCTACATATTTACAAAGG - Intergenic
1010079689 6:71845949-71845971 CTCTTTTTAAATAATGACAATGG + Intergenic
1010144113 6:72646114-72646136 TTCAGATTACAGATTAACAATGG - Intronic
1010873289 6:81068774-81068796 CTCTCTTTACAGCTTGAGAATGG - Intergenic
1011048268 6:83111691-83111713 CTAATTTTTAAGATGGACAAAGG - Intronic
1012021623 6:93928445-93928467 ATCATTTTGCAGAGTGATAAGGG + Intergenic
1012073019 6:94647135-94647157 CTCATCCTACAGCTTAACAATGG + Intergenic
1012515995 6:100060209-100060231 CTCATTTTTGAGATTGACGGTGG + Intergenic
1012686277 6:102254069-102254091 CACATTTGAGAGATTAACAAAGG - Intergenic
1013220888 6:108075931-108075953 TTCTTTTTACAGACTGGCAACGG - Intronic
1014155327 6:118102984-118103006 CTAATTTTACAGATGGGTAAAGG - Intronic
1014173268 6:118303155-118303177 CTCATTTTTCATTTTGTCAAGGG + Intronic
1014318099 6:119892107-119892129 CTCGTTTTAAAGATTAAGAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018144453 6:160870514-160870536 CTCATTGATCTGATTGACAATGG + Intergenic
1021835287 7:24666430-24666452 CTCTTTTAACATCTTGACAAAGG - Intronic
1024769877 7:52709357-52709379 CTCTAGTTCCAGATTGACAAGGG + Intergenic
1024801035 7:53078751-53078773 CTGTTTTTACAGATTGAATAGGG - Intergenic
1027784228 7:82559029-82559051 CCCATTTTAAAAATTGACAGAGG - Intergenic
1027806034 7:82823986-82824008 CTCATTTTACATGTTGAAATTGG + Intronic
1028003080 7:85526046-85526068 TCAATTTTACAGATTGAGAAAGG + Intergenic
1028178831 7:87691895-87691917 CTCATTTTACAGATGAGAAAAGG - Intronic
1028282662 7:88950766-88950788 CTCATTTTACAGCTTAAAATAGG - Intronic
1029273094 7:99388558-99388580 CCCACTTTACAGATTAGCAAAGG + Intronic
1030240728 7:107320744-107320766 CTCATTTTACAGTGTGACAGAGG - Intronic
1030891445 7:115003903-115003925 CTCATTTTACAGATGAAAAACGG - Intronic
1031949610 7:127878605-127878627 TTCATAATACAGATTGAAAACGG - Intronic
1031976477 7:128096967-128096989 CTCATTTTATAGGATGAGAAGGG + Intergenic
1032650182 7:133869404-133869426 CTCATTTTACAGATGAAGACAGG - Intronic
1034344959 7:150380178-150380200 TTCATTTTACAGATGAACATGGG - Intronic
1036969321 8:13336681-13336703 CTCATTTTATAGATAAAGAAGGG - Intronic
1037089255 8:14893229-14893251 CTCATTTTAAAGATGGAGGAAGG + Intronic
1037613502 8:20496091-20496113 CTCATTTTACAGAAAAAGAAAGG - Intergenic
1040599017 8:48866141-48866163 CTCATTTAGCAGATTAAAAATGG - Intergenic
1040652239 8:49462269-49462291 CTCATTTTACAGATGAAAAATGG + Intergenic
1041209379 8:55533179-55533201 CTCATTTTCTAGACTCACAATGG - Exonic
1041751454 8:61265422-61265444 CTCACTTTACAGATTAAAAATGG - Intronic
1042765294 8:72314591-72314613 CTCATTTTACAAAAAGATAAGGG + Intergenic
1042892467 8:73627408-73627430 CACATGCTACAGATTGAGAAGGG + Intronic
1043351456 8:79365812-79365834 CTCATTCTACACATTCCCAAAGG + Intergenic
1043375815 8:79648217-79648239 CTCATTTTACAGATTGACAAAGG - Intronic
1045190909 8:99882700-99882722 CTGATTTTACAGATCTAAAAAGG + Intronic
1045665877 8:104483772-104483794 CCCATTTTACAGATGAAGAATGG + Intergenic
1046209328 8:111046805-111046827 CTCATTTTACAGAAAATCAAAGG - Intergenic
1046975922 8:120277373-120277395 CTCATTTGACAGTTTAAAAATGG - Intronic
1046998152 8:120547095-120547117 CTGATTTGTCAGGTTGACAAGGG + Intronic
1047612395 8:126533877-126533899 CTCATTTTTCAGAGTAACAGAGG + Intergenic
1047637481 8:126780251-126780273 CTTATTTTACATATTGCCTATGG + Intergenic
1047806740 8:128368953-128368975 CTCATTTTGCAGATGAAAAAAGG - Intergenic
1048322951 8:133415819-133415841 CTCATTTTTCAGCTTGACAGAGG - Intergenic
1048677978 8:136806087-136806109 CTCACCTTACAGAATGAAAAGGG + Intergenic
1049398345 8:142412339-142412361 CTCATTTTCCAGATGGGAAAAGG - Intergenic
1052113300 9:24617011-24617033 ATCACTTTACAGATTGAATAAGG - Intergenic
1052500094 9:29278153-29278175 CCCATTTTAAAAATGGACAAAGG - Intergenic
1053198976 9:36140020-36140042 CTCATTCTATAGATTTACAGAGG + Intronic
1054877422 9:70111452-70111474 CTCATTTTACAGATGAGCAATGG - Intronic
1055216130 9:73864761-73864783 CTCATTTTAAATATTAATAAAGG - Intergenic
1056513104 9:87324375-87324397 CCCATTTCACAGATTGGAAATGG - Intergenic
1057252775 9:93517118-93517140 CCCATTTCACAGATGGACAGAGG - Intronic
1058264353 9:102879323-102879345 CTTAATTTAAAAATTGACAAAGG - Intergenic
1058669772 9:107351030-107351052 CTCTTTCTACAGATTGTCACAGG - Intergenic
1059704150 9:116804177-116804199 CCCATTTTACAGAATGAGAATGG - Intronic
1060024039 9:120156026-120156048 CCCATTTTACAGCTGGAAAAAGG + Intergenic
1060386815 9:123238008-123238030 CTCATTTTACAGAGACAGAAAGG - Intronic
1060717690 9:125949212-125949234 CTCATTTTATAGATAAAAAATGG - Intronic
1060731157 9:126037877-126037899 ATCATTTTACAGATGGAGTACGG - Intergenic
1061291062 9:129650544-129650566 CCCATTTTACAGACAAACAAAGG + Intergenic
1061648267 9:132024315-132024337 CTCCTTTTACAGATGAAGAATGG + Intronic
1185668011 X:1783069-1783091 CTCATTTTACAGATGAGAAATGG - Intergenic
1188077075 X:25791131-25791153 TTCATTATACAGATTGAAAAAGG + Intergenic
1188254889 X:27949676-27949698 CTCTTTTTCTAGAGTGACAATGG - Intergenic
1188636630 X:32440465-32440487 CTTATTTTATAGATTTACAGAGG + Intronic
1189131244 X:38499959-38499981 CTTATTTTTCAGATTTACTAAGG + Intronic
1190129141 X:47730752-47730774 CTCAGTTTACAGAATCTCAACGG - Intergenic
1192046316 X:67677787-67677809 CTCATTTTACAGATAGGAAAGGG - Intronic
1192294983 X:69837925-69837947 TCCATTTTACAGCTTGACAATGG + Intronic
1194871657 X:99140280-99140302 TTCATTTTACAGATGTAAAATGG - Intergenic
1195434795 X:104829621-104829643 CACATTTTATAAATGGACAAAGG - Intronic
1195740532 X:108060717-108060739 CCCATTTTAAAGATTGGAAACGG - Intronic
1196661840 X:118278696-118278718 CAAAGTTTACAGAGTGACAATGG - Intergenic
1196925309 X:120628453-120628475 CTCATTTTACAGAGAGGAAATGG + Intronic
1198055180 X:132987142-132987164 CACATTTTACAGATGGGGAAAGG - Intergenic
1199059196 X:143333263-143333285 CTTTTTTGACAGTTTGACAAAGG - Intergenic
1199244970 X:145593231-145593253 CCCATTTTACAGATAGTAAAAGG - Intergenic
1199276474 X:145949243-145949265 CTCACTTTACATAGTCACAACGG - Intergenic
1199542157 X:148969025-148969047 CTCATGTAACAGCTTGTCAATGG - Intronic
1200586326 Y:5008999-5009021 CTCATTTTACAGATAAGAAAAGG + Intronic