ID: 1043376153

View in Genome Browser
Species Human (GRCh38)
Location 8:79652032-79652054
Sequence CAGCCACAGCTGCTAAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043376153 Original CRISPR CAGCCACAGCTGCTAAAGGC AGG (reversed) Intronic
900187357 1:1338679-1338701 CAGCCCCAGCATCTGAAGGCGGG + Intronic
900464153 1:2815908-2815930 CAGCCACCGCTGCCAAAGCCTGG - Intergenic
900703529 1:4062251-4062273 CAGACACTGCTGCTGAGGGCAGG + Intergenic
900944500 1:5822239-5822261 CAGCAGCAGCTGCTTATGGCTGG - Intergenic
901142400 1:7043673-7043695 GAGCCACTGCTAATAAAGGCAGG - Intronic
902122269 1:14176436-14176458 CTGCCACAGCTGCCCAGGGCAGG + Intergenic
902617244 1:17630497-17630519 CCCCCACAGCTGCTAAGGCCAGG - Intronic
903137293 1:21317851-21317873 CGGCCACACCTGCTAAAGCCAGG - Intronic
903189075 1:21646410-21646432 AAGTCACAGCTGGTGAAGGCTGG - Intronic
905351043 1:37346649-37346671 CAGACACAGCTGCTGACAGCTGG + Intergenic
905610322 1:39344865-39344887 CAGCGACAGCAGAGAAAGGCAGG - Intronic
906524991 1:46488782-46488804 CAGCCACTGAGGCCAAAGGCTGG + Intergenic
907117880 1:51985746-51985768 CAGTCACAGCTAATAAAGGCAGG - Intronic
911993783 1:104736716-104736738 CTGCCACAGCTGCTCAAGTCTGG + Intergenic
912412624 1:109489017-109489039 CAGCCACCGCTGCTACAACCTGG - Exonic
912681225 1:111730171-111730193 CAGCTACAGCTGCTAAGACCTGG + Intronic
912779546 1:112532305-112532327 CAGCCACAGCTGTTCTTGGCAGG - Intronic
915488890 1:156240808-156240830 CAGCCAGGGCAGCCAAAGGCAGG + Intronic
915852490 1:159340584-159340606 CTGCTACGGCTGGTAAAGGCAGG + Intergenic
917491125 1:175499557-175499579 AAGCCACATCTGCTAAAGCTAGG - Intronic
918758601 1:188371788-188371810 CAGCAAAAGCTGATAAAAGCAGG + Intergenic
919043157 1:192418537-192418559 CTTCCACAGCTGCTAAAGAAGGG + Intergenic
922161019 1:223079275-223079297 CTGCCAGGACTGCTAAAGGCTGG + Intergenic
923669056 1:236024575-236024597 GAGCCACAGTTGCTATAGGAGGG + Intronic
1063584539 10:7339896-7339918 CAGGTACAGATGCTAAATGCTGG + Intronic
1063669364 10:8087570-8087592 CAGCCACAGGTGCTCAGGCCTGG + Intergenic
1064616782 10:17166739-17166761 CAGCTCCAGCTGCTGATGGCAGG - Intronic
1065968625 10:30788312-30788334 CAGCCAGAGCTGCAATAGCCAGG - Intergenic
1067236981 10:44459232-44459254 CAGGCCCAGCTGGTAAAGGCTGG + Intergenic
1067558876 10:47290592-47290614 CTGCCACAGCAGCTCCAGGCAGG + Intergenic
1067985718 10:51141527-51141549 CAGCCACTGCAGGTAAATGCAGG - Intronic
1068571074 10:58630036-58630058 CAGCCACAGCTGCTTGGGCCAGG + Intronic
1068912176 10:62389984-62390006 CAGCCACAGCTAGTCAAGGCTGG - Intronic
1070379746 10:75870008-75870030 CAGCCCCAGGTGAGAAAGGCTGG - Intronic
1070969843 10:80554257-80554279 CAGCACCAGCTCCTAAAGGCAGG - Intronic
1071438495 10:85668779-85668801 AAGACACTGCTTCTAAAGGCAGG + Intronic
1073142806 10:101260371-101260393 CAGCCACAGTGGGCAAAGGCTGG + Intergenic
1075535924 10:123272114-123272136 GAGCCAGAGCAGCAAAAGGCAGG - Intergenic
1076340201 10:129740289-129740311 GAGCCACAGCTGCTGAGGTCCGG + Intronic
1078157269 11:8809768-8809790 CAGCAGCAGCTGCTAAGAGCTGG - Intronic
1078318250 11:10309326-10309348 CAAACAAAGCTGCCAAAGGCAGG + Intronic
1079729420 11:23921400-23921422 CAGCCACAGCTGCCAGGGGTGGG + Intergenic
1079907087 11:26261931-26261953 CAGCACCAGCTGTAAAAGGCTGG + Intergenic
1081813844 11:45927922-45927944 CAGCCCCAGCTGCTCAATGGAGG - Exonic
1083824345 11:65189966-65189988 CAGGCACAGGTGCAGAAGGCTGG - Intronic
1083996142 11:66273653-66273675 CAGCCACGGCTGTTAGATGCAGG - Intronic
1084630866 11:70348429-70348451 CAGCCACAGCAGGGAAAGGGCGG - Intronic
1085803911 11:79617262-79617284 CTGCCACAGGTGCTAAAACCTGG + Intergenic
1089130704 11:116209741-116209763 AAGCCACAGCTGCTACAGGGAGG - Intergenic
1090091323 11:123701042-123701064 CAGCCACAGCCTCACAAGGCCGG - Intergenic
1093447534 12:19277461-19277483 CACCAACAGCTTCTGAAGGCTGG + Intronic
1096616313 12:52835190-52835212 CAGGCACAGCTCCAAAAAGCAGG + Intergenic
1100798783 12:98209986-98210008 CAGCCTCAGGTGCCAAAGCCAGG - Intergenic
1101840927 12:108327125-108327147 GAGCTACAGCTGCTAGAGGGTGG + Intronic
1102007618 12:109598524-109598546 CAGGCCCACCTCCTAAAGGCTGG - Intergenic
1108509864 13:51147047-51147069 CAGCTGCAGCTGCAAAAGGTGGG + Intergenic
1109645955 13:65256229-65256251 CAGCCACATTTGCTAGATGCTGG - Intergenic
1109672860 13:65633003-65633025 CAGCCAGAGCTGCTATGGGAAGG - Intergenic
1113661389 13:112108352-112108374 CAGCCACATCTCCAAAAAGCCGG - Intergenic
1114548023 14:23516532-23516554 CACCCACAGATTCTGAAGGCTGG + Intergenic
1117827765 14:59721245-59721267 CAGCTACAGCAGCTTGAGGCTGG - Intronic
1118050941 14:62027202-62027224 CAGTCACAGATGCTAAGGGGAGG - Intronic
1121431110 14:93889069-93889091 CGGGAACAGCTGCCAAAGGCTGG - Intergenic
1121626353 14:95388204-95388226 CAGCTACAGCTGCAAATGCCAGG - Intergenic
1122236400 14:100332890-100332912 CAGCCACAGCATCTATTGGCAGG - Intergenic
1123097688 14:105774178-105774200 CAGCCACAGGTGCGCAGGGCAGG - Intergenic
1123097733 14:105774354-105774376 CAGCCACAGGTGCACAGGGCAGG - Intergenic
1123997415 15:25728489-25728511 CAGCCACAGCATCAAAAGCCTGG + Intronic
1125146060 15:36469982-36470004 CAGGCAGAGCTGCTACAAGCAGG + Intergenic
1125719522 15:41838662-41838684 CAGGCCCAGCTGGTAAAGGCTGG + Intronic
1125722570 15:41852273-41852295 CAGCCACAGGAGCTGAAGCCCGG - Exonic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1127043463 15:55002009-55002031 CAGCCAAAGCTTCACAAGGCAGG + Intergenic
1127390579 15:58502039-58502061 CAGCCAAAGATGCTTGAGGCTGG + Intronic
1129949516 15:79573515-79573537 CAACCATATCAGCTAAAGGCAGG - Intergenic
1130242684 15:82211166-82211188 CAGCCACAGGTAATAAATGCTGG - Intronic
1132316398 15:100893475-100893497 CAGCCAAAGCTGCTGGAAGCTGG - Intronic
1137231263 16:46569651-46569673 CAGCCACAGCCGCTGCAGTCCGG + Intergenic
1139599014 16:67975561-67975583 TAGCCACAGCTGCTCAAGGTGGG - Intergenic
1139656985 16:68394656-68394678 CAGTCACAGCTGCTTTGGGCAGG + Intronic
1139905110 16:70359736-70359758 CAGCCCCAGCTACTCAAGGGTGG + Intronic
1139910041 16:70392095-70392117 CAGCCACAGGCGCTGGAGGCAGG - Intronic
1142607889 17:1091957-1091979 CAGACAAGGCTGCCAAAGGCAGG + Intronic
1143193478 17:5057711-5057733 GGGCCACAGCCCCTAAAGGCAGG + Intergenic
1143336343 17:6174402-6174424 CAGGCCCAGCTCCAAAAGGCGGG + Intergenic
1146940960 17:36844259-36844281 CTGCCACTCCTGCCAAAGGCAGG + Intergenic
1148101404 17:45094091-45094113 CAGCCCCAGCTGCTCCAGTCAGG - Intronic
1149437156 17:56642948-56642970 GAGCCAGAGCACCTAAAGGCAGG + Intergenic
1153275173 18:3360793-3360815 CTGCCACGGCTGTAAAAGGCAGG + Intergenic
1153761312 18:8334902-8334924 CATCCTCAGCTGCTGATGGCTGG + Intronic
1153825503 18:8870538-8870560 AAGTCACAGCTGCTAAAAGATGG - Intergenic
1154339476 18:13491262-13491284 CAGCCACAGATGGAAAAGGGAGG - Intronic
1158711209 18:59839727-59839749 CAGCCACAGGTTCTAGGGGCTGG + Intergenic
1159266150 18:66082274-66082296 CAGCTACTGCTGCTAAAAGTAGG - Intergenic
1159577409 18:70196559-70196581 CATGCACAGCTGCTGCAGGCAGG + Exonic
1159897204 18:74008562-74008584 CCACCACAGCTGCTGAAGGCAGG + Intergenic
1162692003 19:12440840-12440862 CAGCCACAGCCGATTACGGCCGG + Intronic
1163161837 19:15469537-15469559 CGGGCACAGCTGTTACAGGCAGG + Intronic
1163297864 19:16424090-16424112 CAGCCACAGGTCCCAAAGGAAGG + Intronic
1164558688 19:29273425-29273447 CAGGCAGAGCTGCCACAGGCTGG + Intergenic
1166369998 19:42295166-42295188 CCTCCACAGCTGCCACAGGCAGG + Exonic
1166376667 19:42331267-42331289 CAGCCACCACTGCCAATGGCTGG - Intronic
1167665376 19:50820425-50820447 CAGCCAGAGCTGGTAATTGCTGG + Exonic
924963726 2:57341-57363 CAGCTGCAGCTGCCAAAGTCTGG + Intergenic
925669861 2:6300105-6300127 CAGTCACAGCTCCTACACGCAGG + Intergenic
926002761 2:9347077-9347099 CGGCGATGGCTGCTAAAGGCAGG - Intronic
927393441 2:22622438-22622460 CAGCCTCATCTGCTAAAGAAAGG + Intergenic
931725103 2:65101994-65102016 CAGCCTCAGCCTCTAAATGCTGG + Intronic
934762387 2:96863886-96863908 CAGGCATGGCTGCTCAAGGCTGG - Intronic
936450740 2:112632175-112632197 GAGCCACAGCGGGGAAAGGCAGG + Intergenic
937413645 2:121697495-121697517 CAGCCTCAGAGGCTAAGGGCTGG + Intergenic
937434730 2:121871018-121871040 CAACCACATCTCCAAAAGGCAGG - Intergenic
937436850 2:121888081-121888103 CAGTCACAGCAGCCAGAGGCTGG - Intergenic
938583743 2:132669999-132670021 CAGCCACAGCCGCTGCAGCCGGG - Exonic
941811063 2:169756576-169756598 GAGCCACAGCTGCTACAGCCTGG - Intronic
941843433 2:170111216-170111238 GTGCCACAGCTGGTAGAGGCAGG + Intergenic
942124048 2:172805260-172805282 CAGCCCCAGCTCCTAAGGGAGGG - Intronic
943906925 2:193511165-193511187 AAGCCAAAGCAGCTAATGGCAGG + Intergenic
944446512 2:199796673-199796695 CAGTCTCTGCTGCTAAAGTCTGG + Intronic
1170122841 20:12928730-12928752 CAGCCAGAGCTGATGAAGACAGG - Intergenic
1170678933 20:18507933-18507955 CACCCACAGCTGCAACAAGCAGG - Exonic
1176369290 21:6052776-6052798 CAGTAACAGCTGCTGAGGGCTGG + Intergenic
1178254790 21:31042193-31042215 TAGCCACGGCTGGTACAGGCTGG + Intergenic
1178911128 21:36674541-36674563 CTGCCACGGCTTCTGAAGGCTGG - Intergenic
1178938387 21:36883942-36883964 CAGCCACAGCCCCGAAAAGCCGG + Intronic
1179186022 21:39085819-39085841 CAGCCAGAGCTGGAAAGGGCTGG - Intergenic
1179339036 21:40486960-40486982 CAAGCAGAGTTGCTAAAGGCAGG - Intronic
1179754229 21:43485765-43485787 CAGTAACAGCTGCTGAGGGCTGG - Intergenic
1180154556 21:45971664-45971686 CAGCCACAGCTCCGTAAGGTGGG + Intergenic
1184130991 22:42516248-42516270 CAGCCACATCTGCCCAAGCCGGG + Intronic
1184141161 22:42578073-42578095 CAGCCACATCTGCCCAAGCCGGG + Intergenic
952291696 3:32023059-32023081 GAGCCACAGAAGCTAAAGTCAGG - Intronic
954256855 3:49413018-49413040 CATCCAGAGCTGCAGAAGGCTGG - Intronic
954394746 3:50287575-50287597 CAGCCTCAGCTCTTAAAGACAGG + Exonic
957153132 3:76512391-76512413 CAGCAACAGCTGACAATGGCAGG - Intronic
960362131 3:116725649-116725671 CAGCTACACCTGCTGAAGACGGG + Intronic
960867212 3:122213844-122213866 CAACCACAGCTGCAATAGTCAGG - Intronic
962364975 3:134772814-134772836 CTGCCACAGGAGCTGAAGGCGGG + Intronic
962848889 3:139293284-139293306 CAGCCTCAGCCGCTCCAGGCTGG + Intronic
963265472 3:143235730-143235752 CAACCACATCTGCTACAGGGTGG + Intergenic
965671950 3:171156734-171156756 CAGTATCTGCTGCTAAAGGCAGG + Intronic
965822244 3:172696229-172696251 TAGTCACAGGTGCTAAAGTCAGG + Intronic
965842414 3:172922137-172922159 CAGCCACAGCTTCATAAGGGAGG - Intronic
968478268 4:822843-822865 GAGCCAGAGCTGCTGAGGGCGGG - Intronic
969054563 4:4393538-4393560 CAGCCACAGGAGGTAGAGGCAGG - Intronic
969058469 4:4416517-4416539 CAGCCACAGCTGCCAAAACAGGG + Intronic
978560677 4:110030437-110030459 TAGCAACAGCTGATAAGGGCAGG - Intergenic
980852970 4:138405645-138405667 CAGCCTTACCTGCTAGAGGCTGG - Intergenic
987103299 5:14612204-14612226 CAGCCACAGCAGCCCATGGCAGG - Exonic
988710313 5:33767728-33767750 CAGGTAAAGCGGCTAAAGGCAGG + Intronic
988736719 5:34029587-34029609 CAGACACAGTTAATAAAGGCTGG - Intronic
988827894 5:34958052-34958074 CAGCCACAGCTGGTTAGGGGCGG + Exonic
990770718 5:59241344-59241366 CAGCCATGGCTGGTACAGGCGGG - Intronic
994285334 5:97957701-97957723 GAGCCACAGAGGATAAAGGCTGG - Intergenic
998182068 5:139952819-139952841 CAGCCTCCTCTGCTAGAGGCTGG - Intronic
998715241 5:144876118-144876140 TAGACACAGCTGCTAAAAGAAGG - Intergenic
1001655645 5:173347468-173347490 GAGGCACAGCTCCTAGAGGCTGG - Intergenic
1001701003 5:173706384-173706406 CAGCTTCAGCTGCTATAGGCTGG + Intergenic
1006166857 6:32070359-32070381 CACCCACAGCTCCCCAAGGCGGG + Intronic
1006912411 6:37571967-37571989 CAGCCTCAGCTGCCAGAGGAAGG + Intergenic
1007414404 6:41683541-41683563 CAGCTACAGCTTCTCAAGCCGGG + Intergenic
1007987697 6:46223749-46223771 CAGCCAGAGCTGCTCCAGGATGG + Intronic
1011276869 6:85641029-85641051 TAGCAACAGCTGCTAAATGTTGG - Intronic
1012143783 6:95656099-95656121 AAGCCTCAGCATCTAAAGGCTGG - Intergenic
1015768563 6:136745460-136745482 CTGCCACAGCAGCCAGAGGCAGG - Intronic
1016297198 6:142586102-142586124 CAGAAAAAGCTGCTCAAGGCTGG - Intergenic
1018804009 6:167244748-167244770 CAGCCTCATCTAATAAAGGCAGG + Intergenic
1018860072 6:167704760-167704782 CAGCGACAGCTGCCAGAGGAGGG - Intergenic
1018953954 6:168395628-168395650 CAGCCAGAGCTGACAAAGGCGGG + Intergenic
1019045408 6:169141774-169141796 AAGTCACAGCTGCTAAAGTGGGG + Intergenic
1019778331 7:2925504-2925526 CAGCCTTAGCTGGCAAAGGCTGG + Intronic
1020350201 7:7210842-7210864 AAGCCACGGCTGTTAAAGCCAGG - Intronic
1021542171 7:21771958-21771980 AAGCCACAGCTGTTAATGTCAGG + Intronic
1022346239 7:29517176-29517198 TAGCCACAGCTCCAAAAGACAGG - Intergenic
1022578955 7:31528563-31528585 CAGCCACTGGTGATGAAGGCAGG + Intronic
1022972737 7:35532246-35532268 GAGTCAGAGCTGCTGAAGGCAGG - Intergenic
1023914185 7:44576199-44576221 CAGCCAAACCTGTTGAAGGCTGG + Intergenic
1024231489 7:47367169-47367191 CAGGCACAGCCGCTACAGCCTGG + Intronic
1024322639 7:48086150-48086172 GAGCAGCAGCTGCTAGAGGCAGG - Intergenic
1024573963 7:50748686-50748708 CCGCCACAGCAGCTAAACACTGG - Intronic
1024752450 7:52483450-52483472 CAGCCACTGATGCTAAAGAGTGG + Intergenic
1025095302 7:56091709-56091731 CAGCCAGAGCTGCTGTTGGCTGG - Intronic
1025156653 7:56613196-56613218 CAGCCACATCACCTAAATGCTGG + Intergenic
1025158342 7:56630565-56630587 CAGCCTCTGCTTCAAAAGGCTGG + Intergenic
1025760231 7:64382546-64382568 CAGCCACATCACCTAAATGCTGG - Intergenic
1026663599 7:72323383-72323405 CAGCCACCACTGCTATAGGGTGG - Intronic
1027794715 7:82678203-82678225 CATCAAAAGCTGCTACAGGCAGG - Intergenic
1029560528 7:101300006-101300028 CAGCTGCAGCTGCTCAGGGCAGG - Intergenic
1029561060 7:101303172-101303194 CAGCTGCAGCTGCTCAGGGCAGG - Intergenic
1031122523 7:117738082-117738104 CAGTCACAGCTGCGGAAGGCAGG + Intronic
1031858973 7:126957320-126957342 CTGCCACAGCTGCTCCAGACAGG - Intronic
1033224961 7:139554215-139554237 CAGCCACAGCTGGAGCAGGCGGG - Intergenic
1033232960 7:139616072-139616094 CACCCACAGGGGCTAAGGGCTGG - Intronic
1033361085 7:140639744-140639766 CAGCACCAGCTGGTTAAGGCAGG + Intronic
1036503912 8:9337903-9337925 AAGCAATGGCTGCTAAAGGCTGG - Intergenic
1036586688 8:10130894-10130916 ATGCCACAGATGCTAAAGCCAGG + Intronic
1037567030 8:20126655-20126677 CAGCCACAGCTAATATGGGCAGG + Intergenic
1037578566 8:20230859-20230881 CAGCCACAGCTGGGGAAGGTGGG - Intergenic
1039084393 8:33765541-33765563 CAGCTTCAGCTGTTAAAAGCTGG - Intergenic
1039443216 8:37610196-37610218 CAGCTGCAGCTGCAAAAGGGAGG + Intergenic
1039826982 8:41183007-41183029 CAGGCAGAGTTGCTTAAGGCTGG - Intergenic
1040357886 8:46637307-46637329 CAGCCACATCACCTAAATGCTGG - Intergenic
1040371355 8:46778967-46778989 CAGCCACATCACCTAAATGCTGG - Intergenic
1040378547 8:46850011-46850033 CAGCCACATCACCTAAATGCTGG - Intergenic
1043376153 8:79652032-79652054 CAGCCACAGCTGCTAAAGGCAGG - Intronic
1044383022 8:91555881-91555903 CAGACACAGGTGCTATAAGCAGG - Intergenic
1045714965 8:105031907-105031929 TATCCACTGCTGATAAAGGCAGG - Intronic
1046538805 8:115551925-115551947 GAGGCACACCTGCAAAAGGCAGG - Intronic
1048539211 8:135327203-135327225 CAGCCACTGCAGCTCAAGCCTGG + Intergenic
1049444570 8:142624108-142624130 CAGCCCAAGCTGCCAAAGGCCGG - Intergenic
1052973904 9:34398353-34398375 CAGCCACAGCTGAGAGAGGAGGG + Exonic
1053450710 9:38192075-38192097 CAGCCAGAGCTGCCATAGCCTGG + Intergenic
1054731108 9:68704028-68704050 CAGCCACATCTGCAAGAAGCAGG + Intergenic
1056374966 9:85998935-85998957 CAGAGACTGCTGCTAAATGCTGG - Intronic
1056455027 9:86751715-86751737 CAACCACAGCAGAGAAAGGCAGG - Intergenic
1057145687 9:92757800-92757822 CGGCCACAGCTGCAAACTGCAGG + Intronic
1060980758 9:127790329-127790351 CAGCCACAGCAGCTCACAGCAGG - Exonic
1062326539 9:136015179-136015201 AGGCCACAGCTGCTGGAGGCTGG + Intronic
1186154965 X:6715895-6715917 CAGGCTGAGCTGCCAAAGGCAGG + Intergenic
1186758728 X:12700935-12700957 CAGCCACAGCAGCTGCAGGGAGG - Intronic
1189973778 X:46442812-46442834 AAGCCACAGCTGCTAAACCAGGG + Intergenic
1190187747 X:48250644-48250666 CAGCAACAACAGCAAAAGGCCGG + Intronic
1191850413 X:65581954-65581976 TAGCCCCAGCTGCTCCAGGCAGG - Intergenic
1192810882 X:74546371-74546393 CAGCCAAAGCTGGTCATGGCTGG - Intergenic
1197163334 X:123347974-123347996 CAGCCACAGCTACTTGAGGGTGG - Intronic
1197758284 X:130011195-130011217 CACCCACAGCTCCCAAGGGCAGG + Intronic
1198495488 X:137187970-137187992 CAGACACAGTTGCTTCAGGCTGG - Intergenic
1199197421 X:145047803-145047825 GAGCCAGAGCTGCTGAAGGAGGG + Intergenic
1199578838 X:149341383-149341405 CAGACACAGCTGATACAAGCAGG - Intergenic
1200337390 X:155364566-155364588 CAACCTCAGCTGCAAAAGACTGG - Intergenic
1200349080 X:155476661-155476683 CAACCTCAGCTGCAAAAGACTGG + Intergenic
1200644695 Y:5767030-5767052 CAGCACCAGCTGGTCAAGGCTGG + Intergenic
1202264350 Y:23002297-23002319 CAGCCACATCACCTAAATGCTGG - Intronic
1202417341 Y:24636039-24636061 CAGCCACATCACCTAAATGCTGG - Intronic
1202453445 Y:25034047-25034069 CAGCCACATCACCTAAATGCTGG + Intronic