ID: 1043378564

View in Genome Browser
Species Human (GRCh38)
Location 8:79678080-79678102
Sequence TGCTCAGCAAAACCTGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043378564_1043378569 -1 Left 1043378564 8:79678080-79678102 CCCTTTCCAGGTTTTGCTGAGCA No data
Right 1043378569 8:79678102-79678124 ATTGGGCAGCGATCACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043378564 Original CRISPR TGCTCAGCAAAACCTGGAAA GGG (reversed) Intergenic
No off target data available for this crispr