ID: 1043378569

View in Genome Browser
Species Human (GRCh38)
Location 8:79678102-79678124
Sequence ATTGGGCAGCGATCACTCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043378564_1043378569 -1 Left 1043378564 8:79678080-79678102 CCCTTTCCAGGTTTTGCTGAGCA No data
Right 1043378569 8:79678102-79678124 ATTGGGCAGCGATCACTCTTTGG No data
1043378568_1043378569 -7 Left 1043378568 8:79678086-79678108 CCAGGTTTTGCTGAGCATTGGGC No data
Right 1043378569 8:79678102-79678124 ATTGGGCAGCGATCACTCTTTGG No data
1043378565_1043378569 -2 Left 1043378565 8:79678081-79678103 CCTTTCCAGGTTTTGCTGAGCAT No data
Right 1043378569 8:79678102-79678124 ATTGGGCAGCGATCACTCTTTGG No data
1043378563_1043378569 0 Left 1043378563 8:79678079-79678101 CCCCTTTCCAGGTTTTGCTGAGC No data
Right 1043378569 8:79678102-79678124 ATTGGGCAGCGATCACTCTTTGG No data
1043378559_1043378569 20 Left 1043378559 8:79678059-79678081 CCAGTCCAACTGACTCCTTTCCC No data
Right 1043378569 8:79678102-79678124 ATTGGGCAGCGATCACTCTTTGG No data
1043378562_1043378569 5 Left 1043378562 8:79678074-79678096 CCTTTCCCCTTTCCAGGTTTTGC No data
Right 1043378569 8:79678102-79678124 ATTGGGCAGCGATCACTCTTTGG No data
1043378560_1043378569 15 Left 1043378560 8:79678064-79678086 CCAACTGACTCCTTTCCCCTTTC No data
Right 1043378569 8:79678102-79678124 ATTGGGCAGCGATCACTCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043378569 Original CRISPR ATTGGGCAGCGATCACTCTT TGG Intergenic
No off target data available for this crispr