ID: 1043383387

View in Genome Browser
Species Human (GRCh38)
Location 8:79726244-79726266
Sequence TTGGATTCACAACATGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043383387_1043383390 -7 Left 1043383387 8:79726244-79726266 CCCTGGCCATGTTGTGAATCCAA No data
Right 1043383390 8:79726260-79726282 AATCCAAACACAACAATGTCAGG No data
1043383387_1043383392 -3 Left 1043383387 8:79726244-79726266 CCCTGGCCATGTTGTGAATCCAA No data
Right 1043383392 8:79726264-79726286 CAAACACAACAATGTCAGGCTGG No data
1043383387_1043383393 12 Left 1043383387 8:79726244-79726266 CCCTGGCCATGTTGTGAATCCAA No data
Right 1043383393 8:79726279-79726301 CAGGCTGGTGTGTGAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043383387 Original CRISPR TTGGATTCACAACATGGCCA GGG (reversed) Intergenic
No off target data available for this crispr