ID: 1043383390

View in Genome Browser
Species Human (GRCh38)
Location 8:79726260-79726282
Sequence AATCCAAACACAACAATGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043383388_1043383390 -8 Left 1043383388 8:79726245-79726267 CCTGGCCATGTTGTGAATCCAAA No data
Right 1043383390 8:79726260-79726282 AATCCAAACACAACAATGTCAGG No data
1043383387_1043383390 -7 Left 1043383387 8:79726244-79726266 CCCTGGCCATGTTGTGAATCCAA No data
Right 1043383390 8:79726260-79726282 AATCCAAACACAACAATGTCAGG No data
1043383386_1043383390 -6 Left 1043383386 8:79726243-79726265 CCCCTGGCCATGTTGTGAATCCA No data
Right 1043383390 8:79726260-79726282 AATCCAAACACAACAATGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043383390 Original CRISPR AATCCAAACACAACAATGTC AGG Intergenic
No off target data available for this crispr