ID: 1043383393

View in Genome Browser
Species Human (GRCh38)
Location 8:79726279-79726301
Sequence CAGGCTGGTGTGTGAGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043383389_1043383393 6 Left 1043383389 8:79726250-79726272 CCATGTTGTGAATCCAAACACAA No data
Right 1043383393 8:79726279-79726301 CAGGCTGGTGTGTGAGAACCAGG No data
1043383386_1043383393 13 Left 1043383386 8:79726243-79726265 CCCCTGGCCATGTTGTGAATCCA No data
Right 1043383393 8:79726279-79726301 CAGGCTGGTGTGTGAGAACCAGG No data
1043383387_1043383393 12 Left 1043383387 8:79726244-79726266 CCCTGGCCATGTTGTGAATCCAA No data
Right 1043383393 8:79726279-79726301 CAGGCTGGTGTGTGAGAACCAGG No data
1043383388_1043383393 11 Left 1043383388 8:79726245-79726267 CCTGGCCATGTTGTGAATCCAAA No data
Right 1043383393 8:79726279-79726301 CAGGCTGGTGTGTGAGAACCAGG No data
1043383391_1043383393 -7 Left 1043383391 8:79726263-79726285 CCAAACACAACAATGTCAGGCTG No data
Right 1043383393 8:79726279-79726301 CAGGCTGGTGTGTGAGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043383393 Original CRISPR CAGGCTGGTGTGTGAGAACC AGG Intergenic
No off target data available for this crispr