ID: 1043385034

View in Genome Browser
Species Human (GRCh38)
Location 8:79739981-79740003
Sequence GACTGCGTTGTGTCTTCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043385034_1043385035 -6 Left 1043385034 8:79739981-79740003 CCAACAGAAGACACAACGCAGTC No data
Right 1043385035 8:79739998-79740020 GCAGTCCAAAGCAAATTCAAAGG No data
1043385034_1043385037 15 Left 1043385034 8:79739981-79740003 CCAACAGAAGACACAACGCAGTC No data
Right 1043385037 8:79740019-79740041 GGAGTTATCCAGAGACAACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043385034 Original CRISPR GACTGCGTTGTGTCTTCTGT TGG (reversed) Intergenic
No off target data available for this crispr