ID: 1043385035

View in Genome Browser
Species Human (GRCh38)
Location 8:79739998-79740020
Sequence GCAGTCCAAAGCAAATTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043385033_1043385035 -5 Left 1043385033 8:79739980-79740002 CCCAACAGAAGACACAACGCAGT No data
Right 1043385035 8:79739998-79740020 GCAGTCCAAAGCAAATTCAAAGG No data
1043385032_1043385035 -2 Left 1043385032 8:79739977-79739999 CCTCCCAACAGAAGACACAACGC No data
Right 1043385035 8:79739998-79740020 GCAGTCCAAAGCAAATTCAAAGG No data
1043385031_1043385035 18 Left 1043385031 8:79739957-79739979 CCTCTTGTTGTTGATAATTTCCT No data
Right 1043385035 8:79739998-79740020 GCAGTCCAAAGCAAATTCAAAGG No data
1043385034_1043385035 -6 Left 1043385034 8:79739981-79740003 CCAACAGAAGACACAACGCAGTC No data
Right 1043385035 8:79739998-79740020 GCAGTCCAAAGCAAATTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043385035 Original CRISPR GCAGTCCAAAGCAAATTCAA AGG Intergenic
No off target data available for this crispr