ID: 1043385037

View in Genome Browser
Species Human (GRCh38)
Location 8:79740019-79740041
Sequence GGAGTTATCCAGAGACAACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043385036_1043385037 -7 Left 1043385036 8:79740003-79740025 CCAAAGCAAATTCAAAGGAGTTA No data
Right 1043385037 8:79740019-79740041 GGAGTTATCCAGAGACAACGCGG No data
1043385032_1043385037 19 Left 1043385032 8:79739977-79739999 CCTCCCAACAGAAGACACAACGC No data
Right 1043385037 8:79740019-79740041 GGAGTTATCCAGAGACAACGCGG No data
1043385033_1043385037 16 Left 1043385033 8:79739980-79740002 CCCAACAGAAGACACAACGCAGT No data
Right 1043385037 8:79740019-79740041 GGAGTTATCCAGAGACAACGCGG No data
1043385034_1043385037 15 Left 1043385034 8:79739981-79740003 CCAACAGAAGACACAACGCAGTC No data
Right 1043385037 8:79740019-79740041 GGAGTTATCCAGAGACAACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043385037 Original CRISPR GGAGTTATCCAGAGACAACG CGG Intergenic
No off target data available for this crispr