ID: 1043386056

View in Genome Browser
Species Human (GRCh38)
Location 8:79748874-79748896
Sequence GCAGGGATTCCGGGGTCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043386048_1043386056 1 Left 1043386048 8:79748850-79748872 CCTGCTAGGAATTCCGGTACTAC No data
Right 1043386056 8:79748874-79748896 GCAGGGATTCCGGGGTCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043386056 Original CRISPR GCAGGGATTCCGGGGTCTCT GGG Intergenic