ID: 1043386062

View in Genome Browser
Species Human (GRCh38)
Location 8:79748912-79748934
Sequence CTTTCTCCAGAGCTGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043386062_1043386067 -5 Left 1043386062 8:79748912-79748934 CCTTCCACCAGCTCTGGAGAAAG No data
Right 1043386067 8:79748930-79748952 GAAAGTGGACAGGAGAGCACAGG No data
1043386062_1043386071 28 Left 1043386062 8:79748912-79748934 CCTTCCACCAGCTCTGGAGAAAG No data
Right 1043386071 8:79748963-79748985 CCTCCCAACATCCCACAATGAGG No data
1043386062_1043386068 -4 Left 1043386062 8:79748912-79748934 CCTTCCACCAGCTCTGGAGAAAG No data
Right 1043386068 8:79748931-79748953 AAAGTGGACAGGAGAGCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043386062 Original CRISPR CTTTCTCCAGAGCTGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr