ID: 1043386636

View in Genome Browser
Species Human (GRCh38)
Location 8:79755484-79755506
Sequence TTTTTGTTATGGATGAAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043386636_1043386641 12 Left 1043386636 8:79755484-79755506 CCATGTTTCATCCATAACAAAAA No data
Right 1043386641 8:79755519-79755541 GGGCATAAACAGGAAGCCAATGG No data
1043386636_1043386638 -9 Left 1043386636 8:79755484-79755506 CCATGTTTCATCCATAACAAAAA No data
Right 1043386638 8:79755498-79755520 TAACAAAAATATGTGTAAAACGG No data
1043386636_1043386639 -8 Left 1043386636 8:79755484-79755506 CCATGTTTCATCCATAACAAAAA No data
Right 1043386639 8:79755499-79755521 AACAAAAATATGTGTAAAACGGG No data
1043386636_1043386640 2 Left 1043386636 8:79755484-79755506 CCATGTTTCATCCATAACAAAAA No data
Right 1043386640 8:79755509-79755531 TGTGTAAAACGGGCATAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043386636 Original CRISPR TTTTTGTTATGGATGAAACA TGG (reversed) Intergenic
No off target data available for this crispr