ID: 1043386638

View in Genome Browser
Species Human (GRCh38)
Location 8:79755498-79755520
Sequence TAACAAAAATATGTGTAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043386636_1043386638 -9 Left 1043386636 8:79755484-79755506 CCATGTTTCATCCATAACAAAAA No data
Right 1043386638 8:79755498-79755520 TAACAAAAATATGTGTAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043386638 Original CRISPR TAACAAAAATATGTGTAAAA CGG Intergenic
No off target data available for this crispr