ID: 1043386640

View in Genome Browser
Species Human (GRCh38)
Location 8:79755509-79755531
Sequence TGTGTAAAACGGGCATAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043386636_1043386640 2 Left 1043386636 8:79755484-79755506 CCATGTTTCATCCATAACAAAAA No data
Right 1043386640 8:79755509-79755531 TGTGTAAAACGGGCATAAACAGG No data
1043386637_1043386640 -9 Left 1043386637 8:79755495-79755517 CCATAACAAAAATATGTGTAAAA No data
Right 1043386640 8:79755509-79755531 TGTGTAAAACGGGCATAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043386640 Original CRISPR TGTGTAAAACGGGCATAAAC AGG Intergenic
No off target data available for this crispr