ID: 1043387666

View in Genome Browser
Species Human (GRCh38)
Location 8:79764529-79764551
Sequence GCAGCTGGTCAGATGGATTC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 162}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043387659_1043387666 15 Left 1043387659 8:79764491-79764513 CCTAACTAAATCAGAACTGCCAG 0: 1
1: 0
2: 2
3: 14
4: 150
Right 1043387666 8:79764529-79764551 GCAGCTGGTCAGATGGATTCAGG 0: 1
1: 0
2: 3
3: 11
4: 162
1043387663_1043387666 -9 Left 1043387663 8:79764515-79764537 CCTGGCAGATACCAGCAGCTGGT 0: 1
1: 0
2: 1
3: 13
4: 210
Right 1043387666 8:79764529-79764551 GCAGCTGGTCAGATGGATTCAGG 0: 1
1: 0
2: 3
3: 11
4: 162
1043387661_1043387666 -4 Left 1043387661 8:79764510-79764532 CCAGTCCTGGCAGATACCAGCAG 0: 1
1: 0
2: 2
3: 16
4: 193
Right 1043387666 8:79764529-79764551 GCAGCTGGTCAGATGGATTCAGG 0: 1
1: 0
2: 3
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043387666 Original CRISPR GCAGCTGGTCAGATGGATTC AGG Exonic
903943639 1:26948469-26948491 GCAGCAGGTCAGATGGGAGCTGG + Intergenic
906246288 1:44276760-44276782 GCAGTTGGCAAGATGGATTATGG - Intronic
907953426 1:59206117-59206139 TCAGGTGGTCAGATGGACTTGGG + Intergenic
908153244 1:61326287-61326309 GCTTCTGGTCAGATTGATTCAGG - Intronic
911247638 1:95535938-95535960 GCATATGATCAGCTGGATTCTGG + Intergenic
917109420 1:171530140-171530162 GCAGCTGGTCAGTTGGACTTTGG + Intronic
917464528 1:175263913-175263935 GGAGCTGGTTAGAAGGCTTCAGG + Intergenic
918257934 1:182766942-182766964 GAAGCTGGGCACCTGGATTCTGG + Intergenic
920521952 1:206634621-206634643 GCATCTGGTCAGATGTTTTATGG - Intergenic
921265299 1:213416748-213416770 GGAGCTGGCCAGATGGTTTCTGG - Intergenic
921833893 1:219758547-219758569 GAAACTTGTCAGATGGATTTAGG - Intronic
921886641 1:220313912-220313934 GCAGCTGGACACATGGCCTCTGG + Intergenic
923337567 1:232983790-232983812 TCAGCTGGGCAGATGCATTAAGG - Exonic
924198473 1:241635690-241635712 GCAGCTGCAAGGATGGATTCGGG + Exonic
1063265807 10:4449330-4449352 GCAGAAGGTCAGAAGGATTAAGG - Intergenic
1064047934 10:12035053-12035075 GCAGCTGCTCAGATGAAGTAAGG - Exonic
1064248366 10:13687794-13687816 GCACCTGCACAAATGGATTCAGG + Intronic
1065970596 10:30803213-30803235 TCAGCCAGTCAGTTGGATTCGGG - Intergenic
1071460943 10:85895201-85895223 GGAGGTGGTGAGATGGATTCAGG - Intronic
1074721466 10:116269522-116269544 GCAGATTGTCAGATATATTCCGG - Exonic
1074876878 10:117620620-117620642 ACAGCAGGTCACATGGATTCAGG - Intergenic
1075030637 10:119022449-119022471 GCACCTGATCAGCTGAATTCAGG + Intergenic
1075487574 10:122838110-122838132 GCAGCTGGACAGATGAAATGTGG + Intronic
1076061252 10:127416043-127416065 GCAGCTGGGCAGAGAGATGCCGG - Intronic
1076807729 10:132867339-132867361 GCTGCGGGTCAGAGGGATTCTGG + Intronic
1076900644 10:133335900-133335922 GCAGATGGACAGATGGATGGCGG + Intronic
1077677060 11:4204432-4204454 GGGGCTGCTCAGATGGATGCTGG - Intergenic
1078337768 11:10477331-10477353 GCAGGTGGTCAGTTGGTTTCTGG + Intronic
1078860065 11:15238837-15238859 CCAGCTGGACAGATGGCTGCAGG - Intronic
1081715029 11:45244036-45244058 GCAGCTGGGCAGCTGGTTACAGG + Exonic
1083347775 11:62005595-62005617 GCAGCTGGTCAGGTGGAGTCAGG - Intergenic
1084440152 11:69168121-69168143 GCAGCAGGGCAGAGGGGTTCTGG + Intergenic
1089331313 11:117690866-117690888 GCAGCTGCTCTGATGGAAGCAGG - Intronic
1091454947 12:599948-599970 GCAGCTGGGCAGAAGGAGGCGGG - Intronic
1091767390 12:3130493-3130515 GGAGCTGGGCAGATGGTGTCTGG + Intronic
1092918399 12:13208827-13208849 GCATATGGTCAGGTGGATCCAGG + Intronic
1094208794 12:27868782-27868804 GCAGCTTTTCAGATGGAGTTTGG + Intergenic
1095065994 12:37775658-37775680 GCAGTTGGTCAGAATGCTTCTGG - Intergenic
1096193018 12:49632485-49632507 GGAGCAGGACACATGGATTCTGG + Intronic
1097250709 12:57631061-57631083 GCAGCTGGTCAGCTGGGGACTGG + Exonic
1099428761 12:82555127-82555149 GCAGGTGGTCATAGGGATCCTGG - Intergenic
1101969980 12:109306078-109306100 GCACCTGGGCACCTGGATTCAGG + Intronic
1103944719 12:124519613-124519635 GGAAGTGGTCAGATGGACTCTGG + Intronic
1106448201 13:29855579-29855601 GGAGCTGGGCAGAAGGAATCTGG - Intergenic
1106905943 13:34408873-34408895 GCAGTTGGTAAGATGGAGTTGGG - Intergenic
1107146515 13:37066432-37066454 GCAGCTGGAGAGAGGGAGTCAGG - Intergenic
1108301317 13:49079488-49079510 GCAGTTGGTCAGATGGACAAAGG + Intronic
1109226453 13:59701814-59701836 GCAGGTGGGCAGATGAATACAGG - Intronic
1109909267 13:68889069-68889091 GCAGGTGATCAGAAAGATTCAGG + Intergenic
1111404378 13:87783534-87783556 GCAGCTGCTCATACGGATTTAGG - Intergenic
1112204814 13:97314240-97314262 GCAGCAGGTCTGATAGCTTCTGG - Intronic
1113640253 13:111952247-111952269 GCAGCTGGTCAGTGTGATGCAGG + Intergenic
1120700996 14:87698652-87698674 GCAGCTGGGCAGAAGGAGCCTGG - Intergenic
1120860841 14:89253818-89253840 TCAGCTGCCCTGATGGATTCCGG + Intronic
1202888224 14_KI270722v1_random:128937-128959 TCATTTGGTCTGATGGATTCAGG + Intergenic
1202889484 14_KI270722v1_random:142304-142326 TCATTTGGTCTGATGGATTCAGG + Intergenic
1124231200 15:27947627-27947649 GCAGCTGGACACATGCACTCTGG + Intronic
1125690564 15:41592937-41592959 GCAGGTGATCAGAATGATTCAGG - Intergenic
1126914547 15:53451374-53451396 GCAGCAGTTCAATTGGATTCTGG - Intergenic
1128235982 15:66067501-66067523 GCAGCAGGAGAGCTGGATTCTGG - Intronic
1128370812 15:67037830-67037852 GCAGCTGGTTAGAATGCTTCTGG - Intergenic
1129897031 15:79116080-79116102 GCAGCTGGATAGATGGATAAAGG + Intergenic
1132077144 15:98831312-98831334 GTGGGTGGTGAGATGGATTCTGG - Intronic
1148877102 17:50695514-50695536 GATACTGGACAGATGGATTCTGG - Exonic
1151832946 17:76566407-76566429 GCAAGTGGGGAGATGGATTCAGG + Intronic
1152158390 17:78650226-78650248 GCTGCTGGTCAGCTGGAAACGGG + Intergenic
1152202687 17:78956306-78956328 GCAGGGGGTCAGGGGGATTCCGG + Intergenic
1152929623 17:83103212-83103234 GCAGCAGGACAGGTGGATCCTGG - Intergenic
1156504022 18:37577677-37577699 GCAGCTGGTGTGGTGGGTTCTGG - Intergenic
1156713254 18:39974465-39974487 GAAGCTGGTCAGTTGCATTAGGG - Intergenic
1157397475 18:47354966-47354988 GCAGCTGGTCTGATAGCTCCAGG + Intergenic
1157746891 18:50143833-50143855 GCAGGTTGCCAGATGGATTAAGG - Intronic
1161768413 19:6218978-6219000 GCAGCTGGTCTGCTGGATTCTGG + Intronic
1163716820 19:18877847-18877869 GCAGAGGGTCACATGGGTTCTGG - Intronic
1164679864 19:30126939-30126961 GCACCAGGGCAGATGGACTCAGG - Intergenic
1167215415 19:48161278-48161300 GCAGCTGTTCAGGAGAATTCTGG - Intronic
1168414476 19:56159781-56159803 GCAGCAGGTGAGCTGGTTTCAGG - Exonic
1202663618 1_KI270708v1_random:95729-95751 TCATTTGGTCTGATGGATTCAGG + Intergenic
1202664887 1_KI270708v1_random:109072-109094 TCATTTGGTCTGATGGATTCAGG + Intergenic
925618885 2:5770844-5770866 GCAGCTGGTGAGCTGGACACTGG + Intergenic
928235008 2:29531683-29531705 GCAGCTGGTCCTCTGGCTTCTGG + Intronic
928730404 2:34225174-34225196 TCAGCTGGGCAGTTGGATTTAGG + Intergenic
929353978 2:40996838-40996860 GGAGCTGGGCGGATGGTTTCGGG + Intergenic
933716661 2:85366463-85366485 GCAGCGGGTGAGATGGGTCCAGG - Intronic
936439918 2:112542483-112542505 GCAGGTGGCCACATGGATCCTGG + Exonic
937308321 2:120885667-120885689 GCAGGTGGGCAGAGGGACTCAGG + Intronic
945442053 2:209891793-209891815 ACAGCTTGTCAAATGGATTAAGG - Intronic
945809203 2:214527630-214527652 TCAGATGGTAAGATGGAATCAGG - Intronic
946791772 2:223308188-223308210 GCTGCAGGTCAGTTGGATTTAGG - Intergenic
946927074 2:224636689-224636711 GGAGAGGGTGAGATGGATTCGGG - Intergenic
948415048 2:237797047-237797069 GCTGCTGGGCAGATGGCATCTGG - Intronic
948638535 2:239358092-239358114 CCGGCTGCTCTGATGGATTCAGG - Intronic
949020784 2:241740164-241740186 GTAGGTGGACAGATGGATTTAGG + Intronic
1169214105 20:3783921-3783943 GCAGCTGGACGGCTGGACTCTGG + Exonic
1173270545 20:41530339-41530361 GCAGCTGGCAAGATGGACTGAGG + Intronic
1174846137 20:53944935-53944957 CCAACTGGTCCGATGGATACTGG + Exonic
1174956833 20:55106654-55106676 GCAGCTGACCAGATTGATTTGGG - Intergenic
1177074138 21:16550766-16550788 GAAGCTGGTCAGTTGGACTGGGG - Intergenic
1180330351 22:11472613-11472635 TCATTTGGTCTGATGGATTCAGG + Intergenic
1182421029 22:30248659-30248681 GCCCCTGGTCACATGGATTTGGG - Intergenic
1184527210 22:45031643-45031665 TCAGGTGGTCTAATGGATTCAGG + Intergenic
951158580 3:19386751-19386773 GCTGCTTTTCAGATGGATTATGG + Intronic
954437002 3:50501592-50501614 GCAGTTGGTCAGATGGCTTCTGG - Intronic
955839796 3:63099672-63099694 ACAGTAGGTCAGATGGCTTCAGG + Intergenic
957091052 3:75730661-75730683 TCATTTGGTCTGATGGATTCAGG - Intronic
957092364 3:75744007-75744029 TCATTTGGTCTGATGGATTCAGG - Intronic
958849563 3:99307653-99307675 GCAGGTGGGTAGATGGTTTCAGG - Intergenic
960968712 3:123123986-123124008 GCAGCTGGACAGATGGCGTGTGG + Intronic
961659936 3:128463302-128463324 CCAGCTGGTCAGATGGACGGGGG + Exonic
966421307 3:179737137-179737159 GCAGCTAGTAGGATGGACTCAGG + Intronic
966688703 3:182722951-182722973 CCAGCAGGACTGATGGATTCTGG - Intergenic
969502519 4:7561760-7561782 ACAGATGGACAGATGGATTGAGG - Intronic
971589010 4:28442962-28442984 GCAGCTCACCAGATGGATCCAGG - Intergenic
972218726 4:36927511-36927533 GCTGCTGATCAGATGGAATAGGG + Intergenic
976472392 4:85445035-85445057 GCAGCTGGCCATATGGAGGCAGG - Intergenic
976530464 4:86146379-86146401 GAAGCTGGTCAGAGGGGTACTGG + Intronic
978150920 4:105433720-105433742 GCAGCTGGTAAGAAGCATGCCGG - Intronic
983701565 4:170601973-170601995 GCAGCTGACCTGATGGATTCTGG + Intergenic
987255337 5:16144543-16144565 TCAGCTGGTTTGATGGATTTGGG + Intronic
988123691 5:27001143-27001165 GGAGCTGGAAAGATGGCTTCAGG + Intronic
990854957 5:60254475-60254497 GCATCAGGGCAAATGGATTCTGG - Intronic
992812518 5:80403759-80403781 ACAGCTGGTCAGTTGTACTCTGG - Intergenic
993581712 5:89670176-89670198 ACAGGTGGTGTGATGGATTCAGG + Intergenic
997341138 5:133145560-133145582 CCAGCTGGGCTCATGGATTCGGG - Intergenic
998849391 5:146339069-146339091 GCAGCGGGTGACATGGAATCAGG - Exonic
1001474477 5:172040359-172040381 CCTGCTGGTCAGAAGGTTTCTGG + Intergenic
1001989641 5:176105677-176105699 GCAGCAGGACAGGTGGATCCTGG + Intronic
1002164624 5:177336761-177336783 GCAGCGGGTCAGTTAGATTTGGG - Intronic
1002227229 5:177732460-177732482 GCAGCAGGACAGGTGGATCCTGG - Intronic
1002266914 5:178041311-178041333 GCAGCAGGACAGGTGGATCCGGG + Intronic
1003192199 6:3884151-3884173 GCAGCTGCTCAGATGCACACAGG + Intergenic
1005493270 6:26366794-26366816 GCAGCTGGTATGATGGCTGCAGG + Intronic
1006929670 6:37680215-37680237 GCAGCTGGAGAGGAGGATTCTGG - Intronic
1007753044 6:44081583-44081605 GCTGCGGGGCAGAGGGATTCTGG - Intergenic
1015849115 6:137553255-137553277 GCAACTGGGCAGATGGATGGAGG + Intergenic
1018954822 6:168402285-168402307 GCAGCTGGGGTGATGGATCCTGG - Intergenic
1022194134 7:28047711-28047733 GGAGATGATCATATGGATTCTGG + Intronic
1022809628 7:33856169-33856191 GCAGTGGGTCAGAGGGATTATGG + Intergenic
1023348206 7:39293182-39293204 GCTGCGGGTCAGCTGGCTTCTGG + Intronic
1023726872 7:43151427-43151449 GCAGCAGATCAGATGGGTTGGGG + Intronic
1026085874 7:67262578-67262600 GGAGCTGGTCAGGTGGATGGAGG - Intergenic
1026115465 7:67492043-67492065 GGAGCTGGTCACATGGACTGTGG + Intergenic
1026691292 7:72552296-72552318 GGAGCTGGTCAGGTGGATGGAGG + Intergenic
1027343841 7:77237518-77237540 GCAGGTGGGCAAAAGGATTCTGG + Intronic
1031964074 7:128014837-128014859 GGAGCTGGTGGGATGGATACAGG - Intronic
1034829438 7:154296502-154296524 GCAGCTGGACACATGGGCTCAGG + Intronic
1036510116 8:9392264-9392286 GAAGCTGGACAGATAGATGCTGG + Intergenic
1037116608 8:15236476-15236498 TCAGAGGTTCAGATGGATTCTGG - Intronic
1037157316 8:15719300-15719322 GCAGTTAGTCACATGGATTCTGG - Intronic
1038503042 8:28061258-28061280 GCAACTTGTCATATGGTTTCTGG - Intronic
1038911774 8:31972716-31972738 ACAGCTGGTCAAATGAATACAGG + Intronic
1039240345 8:35549315-35549337 GGAGCTGATGGGATGGATTCGGG - Exonic
1043387666 8:79764529-79764551 GCAGCTGGTCAGATGGATTCAGG + Exonic
1045848069 8:106660281-106660303 GCTGCTTCTCAGATGGATTTTGG + Intronic
1048342855 8:133554267-133554289 GCAGATGGTCATGTGCATTCAGG - Intronic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049312542 8:141940945-141940967 GAAGCAGGACAGATGGATTCGGG - Intergenic
1049672242 8:143875102-143875124 GCAGCTGGGCACATGGTTTTGGG - Intronic
1050268144 9:3913049-3913071 GGAGCTGGTAAGATGGATGGGGG - Intronic
1052502731 9:29312932-29312954 GCAGCTAGTCAGATGGTGTTAGG - Intergenic
1055531451 9:77188192-77188214 GCAGCTGGGCAGATAGATGCTGG + Intronic
1056446919 9:86675312-86675334 GTGGCTGGTCGGATAGATTCTGG + Intergenic
1057058592 9:91983154-91983176 ACAGAAGGTCAGATGGATGCTGG - Intergenic
1057761165 9:97875492-97875514 CCAGGTGGACAGAGGGATTCAGG + Intergenic
1059389994 9:113993093-113993115 GCAGCCTGTCAGATGGGTGCAGG - Intronic
1059518502 9:114917914-114917936 GGAGCTGCTAAGATGAATTCAGG + Intronic
1060804949 9:126569443-126569465 GCAGCTGGTTTGATGGATAGTGG - Intergenic
1062177939 9:135174677-135174699 GCAGCTGGTCAGCAGCACTCAGG + Intergenic
1203486610 Un_GL000224v1:61705-61727 TCATTTGGTCTGATGGATTCAGG + Intergenic
1203499232 Un_KI270741v1:3605-3627 TCATTTGGTCTGATGGATTCAGG + Intergenic
1190144194 X:47875629-47875651 TCAGCTGGTCTGCTCGATTCAGG + Intronic
1193808880 X:86027530-86027552 GCAGCTGCAATGATGGATTCAGG + Exonic
1197872679 X:131074152-131074174 GCCTCTGTTCAGATGGCTTCCGG + Intronic
1199499697 X:148496402-148496424 GAAGCTGGTTAGATAGATCCTGG + Intergenic
1199673483 X:150165815-150165837 GCAGGTGGTCAGAGGCAATCTGG - Intergenic
1200972897 Y:9175707-9175729 GCAGCTGGTCACGTGTTTTCAGG + Intergenic
1202138174 Y:21688800-21688822 GCAGCTGGTCACGTGTTTTCAGG - Intergenic