ID: 1043388107

View in Genome Browser
Species Human (GRCh38)
Location 8:79767854-79767876
Sequence GAGTGGGGAAGGCGGGCGAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 815
Summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 748}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043388081_1043388107 17 Left 1043388081 8:79767814-79767836 CCACGCTGAGCCCCTTCCCAGGG 0: 1
1: 0
2: 4
3: 38
4: 368
Right 1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG 0: 1
1: 0
2: 2
3: 64
4: 748
1043388097_1043388107 -6 Left 1043388097 8:79767837-79767859 CCCTGGGGAGGGCGGGGGAGTGG 0: 1
1: 0
2: 6
3: 74
4: 715
Right 1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG 0: 1
1: 0
2: 2
3: 64
4: 748
1043388092_1043388107 1 Left 1043388092 8:79767830-79767852 CCCAGGGCCCTGGGGAGGGCGGG 0: 1
1: 0
2: 6
3: 87
4: 678
Right 1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG 0: 1
1: 0
2: 2
3: 64
4: 748
1043388077_1043388107 27 Left 1043388077 8:79767804-79767826 CCATCCTTTCCCACGCTGAGCCC 0: 1
1: 0
2: 1
3: 35
4: 331
Right 1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG 0: 1
1: 0
2: 2
3: 64
4: 748
1043388086_1043388107 7 Left 1043388086 8:79767824-79767846 CCCCTTCCCAGGGCCCTGGGGAG 0: 1
1: 1
2: 10
3: 98
4: 604
Right 1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG 0: 1
1: 0
2: 2
3: 64
4: 748
1043388079_1043388107 18 Left 1043388079 8:79767813-79767835 CCCACGCTGAGCCCCTTCCCAGG 0: 1
1: 0
2: 0
3: 28
4: 285
Right 1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG 0: 1
1: 0
2: 2
3: 64
4: 748
1043388087_1043388107 6 Left 1043388087 8:79767825-79767847 CCCTTCCCAGGGCCCTGGGGAGG 0: 1
1: 2
2: 11
3: 78
4: 636
Right 1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG 0: 1
1: 0
2: 2
3: 64
4: 748
1043388089_1043388107 5 Left 1043388089 8:79767826-79767848 CCTTCCCAGGGCCCTGGGGAGGG 0: 1
1: 0
2: 7
3: 114
4: 762
Right 1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG 0: 1
1: 0
2: 2
3: 64
4: 748
1043388078_1043388107 23 Left 1043388078 8:79767808-79767830 CCTTTCCCACGCTGAGCCCCTTC 0: 1
1: 0
2: 4
3: 30
4: 311
Right 1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG 0: 1
1: 0
2: 2
3: 64
4: 748
1043388099_1043388107 -7 Left 1043388099 8:79767838-79767860 CCTGGGGAGGGCGGGGGAGTGGG 0: 1
1: 1
2: 11
3: 145
4: 1190
Right 1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG 0: 1
1: 0
2: 2
3: 64
4: 748
1043388094_1043388107 0 Left 1043388094 8:79767831-79767853 CCAGGGCCCTGGGGAGGGCGGGG 0: 1
1: 2
2: 16
3: 179
4: 1168
Right 1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG 0: 1
1: 0
2: 2
3: 64
4: 748

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043388107 Original CRISPR GAGTGGGGAAGGCGGGCGAG GGG Exonic
900166193 1:1245153-1245175 AAGTGGGGGAGGAGGGGGAGTGG - Intronic
900182092 1:1315671-1315693 GAGTGAGGGAGGCGGGGGACGGG + Intronic
900323424 1:2095912-2095934 GAGAGGGGAAGGGAGGGGAGAGG - Intronic
900703131 1:4060321-4060343 GAAAGGGGGAGGCGGGAGAGGGG + Intergenic
900849374 1:5130436-5130458 GAGTGGGGAAGTTGAGGGAGTGG + Intergenic
900965993 1:5959030-5959052 GAGTGGGGGCGGGGGGCGGGGGG + Intronic
900975069 1:6011728-6011750 AAGTGGTGGAGGTGGGCGAGAGG + Intronic
901472287 1:9466035-9466057 GAGTGGTGCAGGCAGGGGAGAGG - Intergenic
901728723 1:11262512-11262534 CAGCGGGGAAGGCGGGCGGTGGG - Intergenic
901759076 1:11459081-11459103 GAGGGGGGCAGGCGGGAGTGAGG - Intergenic
901817790 1:11804921-11804943 GAGTGAGGAACGGGGGCGGGGGG + Intronic
901915453 1:12495994-12496016 AAGTGGGGAGGGCGGTAGAGGGG - Intronic
901922996 1:12549277-12549299 GTTTGGCGAAGGCGGGCGGGCGG - Intergenic
901934217 1:12616816-12616838 AAGGGGGGAAGGCGGGGGAGGGG + Intronic
902514958 1:16985125-16985147 GAGGGGGTAAGGTGGGAGAGAGG + Intergenic
902710776 1:18238296-18238318 CAGTGGGGAATGGGGGTGAGAGG + Intronic
903406772 1:23103900-23103922 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
903665636 1:25005810-25005832 GAGTTGGGAAGGAGGAGGAGCGG + Intergenic
903668520 1:25022297-25022319 GGGTGGGGTAGGAGGGGGAGGGG - Intergenic
903875984 1:26473070-26473092 GCGCGGGGAACGTGGGCGAGGGG - Intronic
904004613 1:27357208-27357230 GAGTGGGGTGGGCGGGCTTGAGG + Intronic
904391534 1:30189303-30189325 GAGTGGGGAGGGAGGGTGTGGGG - Intergenic
904495754 1:30885765-30885787 GATGGGAGAAGGCGGGCGGGTGG - Intronic
904784077 1:32972708-32972730 GAGAAGGGAAGGGGGACGAGAGG + Intergenic
904919291 1:33994268-33994290 GAGTGGGGTAGGTGAGCGAGAGG + Intronic
905434855 1:37949242-37949264 GAGTGGGGAAGAGGGGCAAGGGG - Intergenic
905649375 1:39646317-39646339 GAGCGGGGGAGGAGGGCAAGGGG - Intergenic
905789725 1:40783733-40783755 GATTTGGGAAGGCGGCCGCGGGG + Intergenic
906125726 1:43425952-43425974 GAGTGGGGCAGGCGGCCCACTGG + Intronic
906283312 1:44568677-44568699 GAGTTGCGAAGGCAGGAGAGTGG + Intronic
906341731 1:44986720-44986742 GAGGAGGGAAGGCGGGCCGGAGG + Intronic
906719970 1:47997379-47997401 GAGAGAGGAGGGCGGGAGAGCGG + Intergenic
907255193 1:53173576-53173598 GAGAGGGGAAGGGAGGGGAGGGG - Intergenic
907305238 1:53509477-53509499 GGGAGGGGAGGGCAGGCGAGGGG + Intronic
908269153 1:62406229-62406251 AAGTAGGGAAGGAGGGAGAGGGG + Intergenic
908611518 1:65865887-65865909 GAGTTGGGATGGAGGGAGAGAGG - Intronic
910188855 1:84574501-84574523 GAGTCGGGAAGGGCGGGGAGGGG + Intergenic
912314184 1:108651742-108651764 GAGAGGGGAAGGGAGGGGAGGGG + Intronic
912536481 1:110376760-110376782 GAGTGGGGAGGGATGGTGAGAGG - Intronic
913321466 1:117591578-117591600 GAGGGGGAAAGGAGGGGGAGAGG + Intergenic
913398286 1:118397221-118397243 GAGTGGGGAAGCCTGGAAAGGGG + Intergenic
914672675 1:149883631-149883653 GAGTGAGGAAGGGGGGGAAGAGG - Intronic
915115296 1:153594790-153594812 GAGTGGGGAAGGAGGACATGTGG - Intergenic
915187038 1:154114834-154114856 GAGTGGCCAAGGCAGGAGAGTGG - Intronic
915302088 1:154957481-154957503 GGGTGGGGAAGGCAGGCATGGGG - Exonic
915446659 1:155978196-155978218 GGGTGGGGACTGCGAGCGAGTGG - Intronic
915465264 1:156093932-156093954 GAGTGGGGATGGAAGGGGAGAGG - Intronic
915564972 1:156708039-156708061 GAGTGGGGAAGTGAGGAGAGGGG - Intergenic
915878812 1:159643442-159643464 GAGGGGGGAGGGAGGGGGAGGGG + Intergenic
915940514 1:160115694-160115716 AGGAGGGGAAGGCGGGGGAGAGG + Intergenic
915951563 1:160192891-160192913 GAGAGGGGAGGGCAGGGGAGGGG + Intronic
916793657 1:168146126-168146148 GGGTGGGGAAGGACGGGGAGGGG + Intergenic
917659695 1:177164899-177164921 GAGAAGGGAAAGCGGGGGAGGGG + Intronic
917832514 1:178908078-178908100 GAGTGGGGAGGGTGGGAGAGGGG - Intronic
919078009 1:192836015-192836037 AAGAGGGGAAGGCAGGCGGGTGG + Intergenic
919190581 1:194212181-194212203 GAGGGTGGAAGGTGGGAGAGGGG + Intergenic
919288518 1:195598369-195598391 GAGAGGGGAAGGTAGGGGAGAGG - Intergenic
919494431 1:198246529-198246551 GAGTGGCGAAAGAGGGCCAGAGG - Intronic
920046587 1:203136646-203136668 GAGTGGGGATGGCAGGAGACTGG + Intronic
920335555 1:205242858-205242880 GAGAGGGGAAGGGGGAAGAGAGG + Intronic
920500084 1:206480268-206480290 GAGAGGGGGAGGCGGGCTGGAGG + Intronic
920787136 1:209052022-209052044 GAGGGGGGAAAGCGGGGGTGTGG - Intergenic
921023841 1:211259748-211259770 GAGGGGGGCAGGCGGGCTGGCGG - Intronic
921987247 1:221325768-221325790 GATGGGGGAAGGAGGGAGAGAGG - Intergenic
922124704 1:222711619-222711641 GGGTGGAGAAGGAGCGCGAGAGG + Intronic
922490748 1:226014561-226014583 GAGTGGGGAAGGTTGGGGAAAGG - Intergenic
922618439 1:226976835-226976857 GAAAGGGCAAGGTGGGCGAGAGG + Intronic
923109450 1:230879573-230879595 GAGAGGGGGAGGCCGGCAAGGGG - Intergenic
923400755 1:233614028-233614050 GAGCGGGGCGGGCGGGCGCGCGG + Exonic
923632311 1:235659432-235659454 GGGTGGGGAAGGGAGGGGAGCGG - Intergenic
924234715 1:241991030-241991052 GAGTGGGGAAAGCAGCCCAGAGG + Intergenic
1062812656 10:478042-478064 GAGAGGGGAAGGGAGGGGAGGGG + Intronic
1062841962 10:679233-679255 GTGTGGGGAGGACGGGCGCGGGG - Intronic
1062904336 10:1169789-1169811 TGGTGGTGAAGGCGGGAGAGGGG - Intergenic
1063123132 10:3118685-3118707 GACTGGGGAAGGCGGCCGGGTGG + Intronic
1064114592 10:12567409-12567431 GAGTGGGGAAGGCAGGGATGGGG + Intronic
1065099705 10:22321191-22321213 CTGTGGGGGAGGCGGGCGGGCGG - Exonic
1065811504 10:29447723-29447745 GAGAGGGGAAGGAGGGAGAATGG - Intergenic
1066014665 10:31228788-31228810 TTGTGGGGTAGGGGGGCGAGGGG - Intergenic
1066090519 10:32014393-32014415 GAGTGGGGCAGGGGGGTGTGGGG + Intronic
1066198971 10:33127967-33127989 GAGGGGGGAAGGGAGGGGAGGGG - Intergenic
1067274242 10:44820173-44820195 GAGTGGGGAGGGTGGGTGAGGGG - Intergenic
1067279424 10:44860073-44860095 GAGGGGCAAAGGCGGGCTAGAGG - Intergenic
1067543539 10:47175463-47175485 CAGTGGGGAAGGGGGCCCAGTGG - Intergenic
1067684061 10:48456820-48456842 CAGTGGGGAAGGAGGGAGGGAGG - Intronic
1067849842 10:49747461-49747483 GAGTGGGGAAGGCCATCCAGCGG + Intronic
1068021136 10:51585974-51585996 GAGTGGGGAGGTAGGGCAAGAGG + Intronic
1068066875 10:52143210-52143232 GAATGGGGAAGGCTGGGGGGTGG - Intronic
1069512397 10:69052217-69052239 GAGTGGGGAAGGTGGTGGGGAGG + Intergenic
1069638583 10:69940702-69940724 GAGAGGAGAAGGGGGGCGGGAGG + Intronic
1070484164 10:76913718-76913740 GAAGGGAGAAGGCGGGAGAGCGG + Intronic
1071158876 10:82723313-82723335 GAGAGGGGAAGGATGGAGAGGGG + Intronic
1071328255 10:84537554-84537576 TAGTGGGGAGGGCCGGCGGGAGG + Intergenic
1071618214 10:87095081-87095103 CAGTGGGGAAGGGAGGGGAGGGG + Intronic
1073759216 10:106612330-106612352 AAGGGGGGAAGGGGGGCCAGGGG - Intronic
1074134624 10:110615904-110615926 GTGTGGGGGAGGTGGGGGAGAGG - Intergenic
1074772466 10:116742688-116742710 GGTCGGGGAAGGCGGGCGCGGGG + Intergenic
1075627157 10:123971896-123971918 GAATGGGGAAGGGGGAGGAGGGG - Intergenic
1075712942 10:124540440-124540462 CAGTGGGGTTGGTGGGCGAGCGG - Intronic
1075983117 10:126758440-126758462 GAGTGGGGAAGGGGTGAGTGGGG - Intergenic
1076318874 10:129564206-129564228 GAAGGGGGAAGGAGGGGGAGAGG - Intronic
1076674850 10:132142499-132142521 CAGTGGGGAGGCCGGGGGAGAGG - Intronic
1076722851 10:132400309-132400331 GAGTGGGTAAGGAGGGTGTGGGG + Intronic
1076729829 10:132432673-132432695 GTGTGGGGAGGGGAGGCGAGGGG - Intergenic
1076778107 10:132709299-132709321 GATGGGGGAAGGAGGGGGAGGGG + Intronic
1076793042 10:132786723-132786745 GAGTGAGGCAGGCGGGAGCGGGG + Intergenic
1077062461 11:623893-623915 ACGTGGGGAGGGAGGGCGAGTGG + Intronic
1077248709 11:1551318-1551340 GAGTGGGGTGGGCGGGTGGGTGG - Intergenic
1077271889 11:1685343-1685365 CAGAGGGGAAGGCGGGCAGGTGG - Intergenic
1077328274 11:1972986-1973008 GTGTGGCCAAGCCGGGCGAGTGG - Intronic
1077485945 11:2838503-2838525 GGCTGGGGAAGGGAGGCGAGAGG + Intronic
1077533613 11:3108471-3108493 GGGTGGGGAAGGCTGAGGAGGGG + Intronic
1077719161 11:4609591-4609613 ATGTGGGGAAGGCTGGAGAGAGG + Intergenic
1078016744 11:7621313-7621335 GAGTGGGGAGAGCAGGTGAGTGG + Intronic
1078660430 11:13281335-13281357 GAGTGGGGGAGGCTGGCAGGAGG - Intronic
1081073360 11:38638054-38638076 GGGAGGGGAAGGCAGGAGAGGGG - Intergenic
1082162814 11:48902107-48902129 GAGTGGGGACGGCGGTGGCGGGG + Intergenic
1082238604 11:49850627-49850649 GAGTGGGGACGGCGGTGGCGGGG - Intergenic
1082986016 11:59172089-59172111 GGGTGGGGAGGGAGGGAGAGAGG + Intronic
1083173725 11:60936968-60936990 GAGTGGCGGGGGCAGGCGAGAGG - Exonic
1083657107 11:64234917-64234939 GAGAGGGCACGGCGGGCGGGCGG - Intronic
1083657157 11:64235061-64235083 GACTGGGGCTGGCGGGCCAGCGG - Intronic
1083727480 11:64636107-64636129 GGGTGGGGGAGGGGGGAGAGGGG + Intronic
1083750611 11:64758783-64758805 GAGCAGGGCAGGCGGGCCAGAGG - Intronic
1083766660 11:64844681-64844703 CAGCGGGGAGGGCGGGAGAGGGG - Intergenic
1084021525 11:66420831-66420853 GAGGGAGGGAGGCGGGCGAGGGG - Intergenic
1084053483 11:66616380-66616402 GAGAGGAGAACGCGCGCGAGCGG - Intergenic
1084166309 11:67376278-67376300 CAGTGTGGAAGGTGGGGGAGGGG - Intronic
1084729799 11:71065813-71065835 GAGTGGGGAAGTTGGGGGCGGGG + Intronic
1084729884 11:71066132-71066154 GAGTGGGGAAGTTGGGTGGGGGG + Intronic
1085050241 11:73376636-73376658 GAGTGGGGTGGGGGGGCGCGCGG - Intronic
1085195905 11:74671579-74671601 GAGTGGCAAAGGCGAGGGAGTGG + Intergenic
1085259352 11:75195520-75195542 GAGTGGGGAAGTGGGGCATGGGG - Intronic
1085384891 11:76151941-76151963 GAGTGGGGAAGACGTCAGAGAGG - Intergenic
1085388740 11:76171531-76171553 CAGTGGGGATGGCAGGCGGGAGG + Intergenic
1085643768 11:78209640-78209662 GAGGAGGGAAGGCGAGAGAGAGG - Exonic
1085745160 11:79108908-79108930 GAATGGGGAAGGGGAGAGAGTGG - Intronic
1086697967 11:89865523-89865545 GAGTGGGGACGGCGGTGGCGGGG + Intergenic
1086708195 11:89978965-89978987 GAGTGGGGACGGCGGTGGCGGGG - Intergenic
1087106961 11:94419443-94419465 GAGTGGGGAACGGGGGGGAGAGG + Exonic
1088378528 11:109168280-109168302 GAATGGGGAAGGATGGTGAGAGG + Intergenic
1088596426 11:111444286-111444308 GGGAGGGGAAGGCAGGGGAGGGG + Intronic
1088760199 11:112922321-112922343 GAGTGGGGAACTGGGGAGAGAGG + Intergenic
1089504350 11:118953614-118953636 GGGTGGGGAAGGTGGGGGGGGGG + Intronic
1089525622 11:119094799-119094821 GGGCGGCGAAGGCGGGCGAGGGG + Exonic
1089563433 11:119357342-119357364 GAGGGGGGAAGTCGGGGCAGGGG - Intronic
1089690786 11:120185564-120185586 GGGTGGGGAAGGGAGGGGAGGGG - Intergenic
1089787694 11:120919966-120919988 GAGTGAGGAAGGCTGGCAAGAGG + Intronic
1090172451 11:124616925-124616947 GAGAGGGGAAGGGAGGGGAGGGG - Intronic
1090234826 11:125139588-125139610 TGGTGGGGAAGGAGGGCGAAAGG - Intergenic
1090860746 11:130650412-130650434 AAGTGGGGCAATCGGGCGAGGGG - Intergenic
1091362589 11:134989445-134989467 GTGTGGGGAGGGCGGGGGCGTGG - Intergenic
1202811252 11_KI270721v1_random:28165-28187 GTGTGGCCAAGCCGGGCGAGTGG - Intergenic
1091388753 12:112284-112306 GAGTGGGGAAGTGGGGGGAAGGG + Intronic
1091647399 12:2284207-2284229 GAGTGGGGTAAGCTGGGGAGAGG + Intronic
1091833098 12:3564156-3564178 GAGTGGGGAGGGCGAGCGAAGGG + Intronic
1092162609 12:6324279-6324301 GGGGGGGGGAGGGGGGCGAGGGG - Intronic
1092228888 12:6766278-6766300 GGGTGGGGCAGGCGGGAGCGGGG - Intronic
1092659591 12:10723372-10723394 GGGAGGGAAGGGCGGGCGAGGGG + Intergenic
1092843236 12:12562549-12562571 GAGGGGGAAAGGCGGGGGGGTGG + Intergenic
1093893557 12:24552066-24552088 GAGTGGGGAAGGGGGCCCTGGGG - Intergenic
1094138942 12:27160653-27160675 GAATGGGGAAGAAGGGAGAGGGG + Intergenic
1094586436 12:31781636-31781658 GGGAGGGGAAGGCAGGGGAGGGG + Intergenic
1095327126 12:40908288-40908310 GAGAGGGGAAGGAAGGGGAGAGG - Intronic
1096121728 12:49093022-49093044 GAGTGGGGAGGTGGGGGGAGAGG - Intronic
1096157443 12:49348374-49348396 GAGTTAGGAAGGCAGGAGAGTGG + Intronic
1096628802 12:52912241-52912263 CAGTGGGGAAGGCAGCAGAGGGG + Intronic
1096764135 12:53869160-53869182 GAGAGGGGAAGGAGGGAGAGGGG - Intergenic
1096886135 12:54721256-54721278 GAGAGGAGAAGGAGGGGGAGAGG - Intergenic
1096976619 12:55703009-55703031 GAGTGGGGGAAGCGTGTGAGCGG - Intronic
1097006982 12:55926944-55926966 GAATGGGGAAGGCGGTCCGGGGG + Intronic
1097195020 12:57238404-57238426 GTGTGGGGGGGGCGGGGGAGCGG + Intronic
1097195966 12:57242657-57242679 GAGTGGGGCAGGCGTGTGTGGGG - Intergenic
1097602192 12:61706819-61706841 GAGGGAGGAAGGGGGGAGAGTGG + Intergenic
1098041484 12:66357834-66357856 GTGTGGGGAAGGTGGGGGATGGG + Intronic
1099361164 12:81703563-81703585 AAGTGGAGAAGGAGGGCAAGAGG - Intronic
1099681604 12:85836616-85836638 GGGTGTGGAAAGCGGGGGAGGGG - Intergenic
1100600422 12:96107819-96107841 GTCTGGGGAAGGCAGGGGAGGGG + Intergenic
1100877214 12:98975071-98975093 AAGTAGGGAAGGAGGGAGAGAGG - Intronic
1102863633 12:116357224-116357246 GAGAGGGGAGGGGAGGCGAGGGG + Intergenic
1103036880 12:117664140-117664162 GAGTGGGGAAAGGGAGGGAGGGG - Intronic
1103238909 12:119397797-119397819 GGGTGGGGAAGGGGGGAGGGAGG + Intronic
1103425504 12:120830378-120830400 GAGGGGGGAAGAAGGGGGAGGGG + Intronic
1103425550 12:120830463-120830485 GAGGGGGGAAGAAGGGGGAGGGG + Intronic
1103958532 12:124593219-124593241 GAGAGGGAAAGGCGGGTGGGTGG - Intergenic
1104002418 12:124868705-124868727 GAGTGGGCAAGGAGAGGGAGGGG - Intronic
1104191078 12:126482445-126482467 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
1104191095 12:126482487-126482509 GAGAGGGGAAGGAGGGAGGGAGG - Intergenic
1104191105 12:126482510-126482532 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1104544402 12:129698529-129698551 GAGAGGGGAAGGGAGGGGAGGGG + Intronic
1104674480 12:130703475-130703497 GATTGGGGAGGGCAGGCGGGTGG - Intronic
1104795586 12:131514875-131514897 GCGTGGGGAAGGCTGGCTCGGGG - Intergenic
1104865191 12:131949669-131949691 GACTGAGGAAGGCGGGGGCGGGG - Intergenic
1104950444 12:132437536-132437558 GAGGGAGGAAGGAGGGAGAGAGG + Intergenic
1105437625 13:20391342-20391364 GGGTGGGGAAGGAAGGCGAGGGG + Intergenic
1105437708 13:20391550-20391572 GGGTGGGGAAAGGAGGCGAGGGG + Intergenic
1105586591 13:21750722-21750744 GACTGGGGTGGGCGGGCGGGGGG + Intergenic
1107145853 13:37059705-37059727 GGGCGGGGAAGGCGGGCGGAAGG + Intronic
1107643167 13:42465391-42465413 GAGTGGAGAAGGAGGAAGAGGGG + Intergenic
1107834917 13:44405295-44405317 GAGTGGGGAAGGAAGGTGGGAGG - Intergenic
1108192782 13:47959483-47959505 GAGGGGGGAAGGGGAGCGGGGGG + Intronic
1108571488 13:51756087-51756109 GAGTAGGGAAAGCAGGAGAGTGG + Intronic
1108592467 13:51923726-51923748 GAGAGGGGAAGGAAGGGGAGGGG + Intergenic
1108643655 13:52406198-52406220 GCGTGGGGAGGGCGGGCGCCGGG + Intronic
1109370823 13:61417073-61417095 GAGAGGGGTAGGGGGGTGAGGGG - Intronic
1110863117 13:80365982-80366004 GAGGGGGGAAGGTGGGGAAGGGG + Intergenic
1111739984 13:92192309-92192331 AAATGGGGAAGGTGTGCGAGTGG + Intronic
1111927384 13:94478147-94478169 GGGTGGGGGGGGCGGGCGGGGGG - Intronic
1111951553 13:94712588-94712610 GGGTGGGGAAGGCGGGGAGGTGG + Intergenic
1113039195 13:106085712-106085734 GGGTGGGGAGGGGGGGCGGGGGG + Intergenic
1113417340 13:110138492-110138514 GCGCGGGGCAGGCGGGCGGGCGG + Intergenic
1113660671 13:112104731-112104753 GAGTGGGGACGGCGGGGCACAGG + Intergenic
1113781606 13:112980638-112980660 GAAAGGGGAAGGCGGGGGAAAGG - Intronic
1113899611 13:113788889-113788911 GAGTGGGGCAGGAGGGAGGGAGG - Intronic
1114633208 14:24172683-24172705 GGGTGGGGAAGGTGGGAGAATGG - Intronic
1115123880 14:29970642-29970664 GAGTGGGGGTGGGGGGTGAGGGG - Intronic
1115193392 14:30770579-30770601 GAGTGGGGAGGGCGGGGGCGAGG + Intergenic
1115906990 14:38211220-38211242 GAGTGGTGGTGGCGGGCGGGCGG - Exonic
1116031335 14:39576544-39576566 CAGTGTGGAAGGTGGGCTAGGGG + Intergenic
1116987828 14:51240125-51240147 GAGTGGTGAAGTCGGGAAAGAGG - Intergenic
1118339158 14:64880050-64880072 GGGTGGGGAAGGCGGGGGCTGGG - Intergenic
1118565034 14:67130260-67130282 GAGGAGGGAAGGAGGGAGAGGGG - Intronic
1119263561 14:73251847-73251869 GTGTGGGGAGAGAGGGCGAGTGG + Intronic
1119538626 14:75423895-75423917 GACTTGGGAAGGGGGGCGGGGGG - Intergenic
1120174250 14:81276774-81276796 GAGTGGTGATGGAGGGGGAGTGG - Intronic
1120433096 14:84444272-84444294 GGGAGGGGAAGGCAGGGGAGGGG - Intergenic
1120806177 14:88753214-88753236 GAGTGGGGCATGCAGGTGAGAGG - Intronic
1121018914 14:90567026-90567048 GAAAGGGGAAGGCGGGGGCGGGG + Intronic
1121524957 14:94613279-94613301 GAGTGGGGAAGAGAGGCGATTGG - Intronic
1121955687 14:98210524-98210546 GGGCGAGGAAGGCGGGGGAGGGG + Intergenic
1122075825 14:99233883-99233905 GAGGGGGGCAGCCGGGAGAGGGG + Intronic
1122198664 14:100108658-100108680 GAGAGGGGAAGAAGGGCCAGGGG - Intronic
1122464137 14:101918645-101918667 GAGGGGGCGAGGGGGGCGAGGGG - Intronic
1122540101 14:102493333-102493355 GAGTGGGGAAGGCGGGAGCCTGG + Intronic
1122675575 14:103410275-103410297 GAGTGGGGAAGGAAGGGAAGAGG + Intronic
1122691228 14:103532996-103533018 GAGTGGGTCAGGCTGGCCAGGGG + Intronic
1122707281 14:103629225-103629247 GAGCGGCGCAGGCGGCCGAGCGG + Intronic
1122922005 14:104884213-104884235 GGGTTCGGGAGGCGGGCGAGGGG - Exonic
1123037597 14:105477819-105477841 GTGTGGGGGAGGCGGGTGTGAGG + Intronic
1123205619 14:106710366-106710388 GAATGTGGAAGGTGGGCGGGAGG - Intergenic
1123210669 14:106757641-106757663 GAATGTGGAAGGTGGGCGGGAGG - Intergenic
1124366188 15:29072973-29072995 GAGTGGGGGATGCAGGGGAGCGG - Intronic
1125128643 15:36255040-36255062 GAGTGGGGAAGGTGGGGGGCGGG - Intergenic
1125200982 15:37100572-37100594 GGGTGGGGGAGGCGGGGGGGCGG + Intronic
1126134667 15:45378536-45378558 GAGCGGGGTGGGCGGGCGCGCGG + Exonic
1126406984 15:48331794-48331816 GGGTAGGAAAGGCGGGGGAGGGG + Exonic
1127142748 15:55993798-55993820 GAGTGGGGAGGGCGTGCGGCGGG + Intergenic
1127267117 15:57371347-57371369 GAGTGTGGATGGCTGGCTAGGGG + Intergenic
1127606605 15:60592773-60592795 GCGAGGGGAAGGCGGGCGCCCGG - Intronic
1127657711 15:61071489-61071511 GAGAGGGGAAGGGAGGAGAGAGG + Intronic
1127657721 15:61071506-61071528 GAGAGGGGAAGGGAGGGGAGGGG + Intronic
1128016955 15:64356104-64356126 GAGGGGAGAAGGCGGACGGGAGG + Exonic
1128499154 15:68214995-68215017 GAGAGAGGAAGGCAGGCCAGGGG + Intronic
1128543358 15:68551896-68551918 GAGAGGGGAAGGTGGGCCATCGG - Intergenic
1128803389 15:70512618-70512640 GAGTGGGGAGAGAGGGAGAGGGG + Intergenic
1128806961 15:70538285-70538307 GAGTGGGGAAGGTGGTCAATGGG + Intergenic
1129442096 15:75588890-75588912 GAGGGGGGAAGGAAGGGGAGGGG + Intergenic
1129884445 15:79028678-79028700 GAGTGGGGAAGGGGGGCTTCTGG + Intronic
1130037418 15:80374418-80374440 CAGTGGGGAAGGCAGACCAGAGG - Exonic
1130262634 15:82369902-82369924 GAGTGGGGAAGGAGAGGGAGGGG - Intergenic
1130278593 15:82499045-82499067 GAGTGGGGAAGGAGAGGGAGGGG + Intergenic
1131455322 15:92578921-92578943 GAGAGGGGCAGGAGGGCTAGTGG - Intergenic
1132499401 16:278709-278731 GAGTGGGTAAGGATGGGGAGAGG - Intronic
1132560127 16:589807-589829 GTGTGGGAAAGGCGGGGGAGGGG + Intronic
1132569680 16:638612-638634 GAGTGGGGAAGGTGGGGGCAGGG + Intronic
1133033061 16:3020845-3020867 GAGTTGGGGAGGCCGTCGAGAGG + Intronic
1134449674 16:14355425-14355447 GAGTGGGGGGGGGGGGCGGGGGG + Intergenic
1135183058 16:20291880-20291902 GGGTGGGGGAGGCTGGGGAGGGG - Intergenic
1136365007 16:29805977-29805999 GCGCGGGGAGGGCGGGCGGGGGG - Intergenic
1136368419 16:29820643-29820665 GAGTGGGGAAGGAGGATGGGTGG + Intronic
1136615219 16:31394349-31394371 GGTTGGGGAAGGAGGGTGAGTGG - Intronic
1136663294 16:31784231-31784253 GAGGGTGGAAGGAGGGTGAGGGG - Intronic
1138177577 16:54915243-54915265 GAGTGGTGACGGCGGGGGGGGGG + Intergenic
1138252146 16:55509434-55509456 GAGAGAGGAGGGCGGCCGAGGGG + Intronic
1138252203 16:55509601-55509623 GACGGGGGAGGGCGGTCGAGGGG + Intronic
1138708517 16:58942414-58942436 GGGCGGGGGAGGCGGGGGAGGGG - Intergenic
1139448685 16:67014113-67014135 GGCTGTGGCAGGCGGGCGAGCGG - Intergenic
1140615563 16:76658343-76658365 GAGTGGGGAGGGAGGGAGGGAGG + Intergenic
1140655174 16:77132441-77132463 GAGAGGGGGAGGAGGGGGAGGGG - Intergenic
1140699763 16:77570953-77570975 GAGTGTGGAAGCCGGGGTAGGGG - Intergenic
1140814010 16:78604669-78604691 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814018 16:78604684-78604706 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814026 16:78604699-78604721 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814034 16:78604714-78604736 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814042 16:78604729-78604751 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814050 16:78604744-78604766 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814058 16:78604759-78604781 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814066 16:78604774-78604796 GAGGGGGGAAGGAGGGAGGGGGG - Intronic
1140814090 16:78604824-78604846 GAGGGGGGAAGGAGGGAGGGAGG - Intronic
1141028876 16:80570936-80570958 GAGTGTGGATGGAGGGAGAGTGG - Intergenic
1141762712 16:86039097-86039119 GAGTGGGGAAGGAAGGGGACTGG + Intergenic
1141894986 16:86953644-86953666 GAGCTGGGCAGGCGGGGGAGTGG - Intergenic
1142008479 16:87701645-87701667 GAGTGGACGAGGCGGACGAGTGG - Intronic
1142157442 16:88539124-88539146 GAGTGGGGAGGGGGGAGGAGTGG - Intergenic
1142477032 17:194588-194610 GAGGGAGGAGGGAGGGCGAGCGG + Intergenic
1142652020 17:1359925-1359947 GAGGGGGGGAGGAGGGGGAGGGG + Intronic
1142850562 17:2702682-2702704 GAGTGGGGAGGTCGGGCACGGGG - Intronic
1143116763 17:4585481-4585503 GGGTGGGGAGGGGGGTCGAGGGG + Intronic
1143473336 17:7190014-7190036 GAGTGGGAAATGCGGGAGGGAGG - Exonic
1143485553 17:7251812-7251834 GAGCAGGGAAGGAGGGGGAGGGG + Intronic
1143539810 17:7562238-7562260 GAGCGGGGAAGCCGGGCGGACGG - Exonic
1143590692 17:7884748-7884770 CGGTGGGGGAGGCGGGCGGGCGG + Intronic
1144053635 17:11519072-11519094 GACTGGTGAAGGAGGGAGAGGGG - Intronic
1144206693 17:12984600-12984622 GACTGGGGACGGCTGGCCAGCGG - Exonic
1144436980 17:15251077-15251099 GGGTGGGGAATGCGGGAGAGAGG - Intronic
1144631855 17:16877636-16877658 GAGTGTGGAAGGCAGGTGTGTGG + Intergenic
1144735635 17:17553898-17553920 CAGCGGGGAGGGAGGGCGAGTGG - Intronic
1144781267 17:17809735-17809757 GAGTGGGGCAGGCGGGGGCGCGG + Intronic
1145252036 17:21301968-21301990 GGGTGGGGGAAGCGGGCAAGTGG + Intronic
1146176384 17:30668408-30668430 GAGGGGGGCAGGCGGGGGTGGGG + Intergenic
1146349844 17:32084522-32084544 GAGGGGGGCAGGCGGGGGTGGGG + Intergenic
1146581304 17:34040431-34040453 CAGTGGGGGAGGAGGGGGAGGGG + Intronic
1147142390 17:38466844-38466866 GAGTTGGGCAGGCGGGGGTGCGG - Exonic
1147178203 17:38669771-38669793 GATAGGGGAAGGTGAGCGAGGGG + Intergenic
1147567363 17:41546033-41546055 GGCTGGGGAAGGCAGGGGAGGGG + Intergenic
1147605908 17:41773609-41773631 GTGTGGGGAAGGGGTGCGTGTGG - Intronic
1147990016 17:44326821-44326843 GAGGGGGGCGGGCGGGCGGGTGG + Intergenic
1148194269 17:45701920-45701942 GAGTGTGGAAGGAGGAGGAGAGG + Intergenic
1149263907 17:54907205-54907227 GAATGGAGAAGACGGGAGAGAGG + Intronic
1150060573 17:62065345-62065367 GGGTGGGGAGGGCGGGCGCCCGG - Intergenic
1150249829 17:63699493-63699515 GGGTGGGGGAGGTGGGTGAGGGG - Intronic
1150351579 17:64448949-64448971 GGGTGGGGGGGGCGGGGGAGTGG + Intergenic
1150389104 17:64780689-64780711 GAAGGGGGAAGGCGGGACAGGGG - Intergenic
1150643415 17:66964453-66964475 GCGAGGGGAAGGGAGGCGAGGGG + Intergenic
1151016189 17:70555872-70555894 GAGGGGGAAAGGAGGGAGAGAGG + Intergenic
1151280313 17:73069118-73069140 GAGTGGGGAAGACGGGGTAGGGG - Intronic
1151573284 17:74937908-74937930 GGGTGGGGAGGATGGGCGAGTGG + Intronic
1151708469 17:75785206-75785228 GAGTGGGGAAGGCGGGAGCTCGG + Intronic
1151919298 17:77141323-77141345 GGGCGGGGGAGGGGGGCGAGGGG - Intronic
1152085333 17:78214454-78214476 GACAGGGCAAGGCGGGCGTGGGG - Intronic
1152624037 17:81380122-81380144 GAGTGGGGGGAGCGGGGGAGTGG - Intergenic
1152638021 17:81438119-81438141 GAGAGGGGAGGACGGACGAGGGG - Intronic
1153084519 18:1269029-1269051 GAGTGAGGAAGGCTGGGGAATGG + Intergenic
1153238698 18:3012671-3012693 GAGTGCGGAAGGCGCGCGGGAGG - Intronic
1153675308 18:7451794-7451816 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1153870628 18:9316174-9316196 GAGGGGGGAAGGAGGGAGGGAGG + Intergenic
1153900538 18:9614331-9614353 GCGGGGGGGAGGCGGGCGGGGGG - Intronic
1153939791 18:9968077-9968099 GAGCAGGGAAGAGGGGCGAGGGG - Intergenic
1153955584 18:10093031-10093053 GAGTGAGGATGGAGGGCGAAGGG + Intergenic
1157094907 18:44679316-44679338 CACTGGGGCAGGGGGGCGAGTGG + Intergenic
1157119473 18:44895291-44895313 GAGGGAGGAAGGGGGGAGAGAGG + Intronic
1157194521 18:45610076-45610098 GAGAGGGGATGGTGGGAGAGGGG - Intronic
1157196837 18:45626596-45626618 GGGTGGGGAAGGTGGGGGGGTGG - Intronic
1157334701 18:46729361-46729383 GAGTGGGGAAAGGGGGCCAGGGG + Intronic
1157478410 18:48037616-48037638 GAGTGGGGAAGAAGGGAGATGGG + Intronic
1157683786 18:49627034-49627056 GAGTGGGCAAGGCGTGCCTGTGG - Intergenic
1158393795 18:57064168-57064190 GAGTGGGGGAAGGGGGAGAGAGG + Intergenic
1158610475 18:58935407-58935429 GAGTGGGGGAGGAGGGAGAGGGG - Intronic
1158938227 18:62384465-62384487 GAGGGGGGAAGGGGGAGGAGAGG - Intronic
1158939765 18:62396530-62396552 GCATGGGGAAGGCGGGCAAGTGG - Intergenic
1159108027 18:64026367-64026389 GACTGGGGCAGGAGGGAGAGTGG - Intergenic
1159300053 18:66552056-66552078 GAGAGGGGAAGGAGGGAGTGGGG + Intronic
1159893442 18:73974291-73974313 GAGAGGGGAAGGGGGAAGAGGGG + Intergenic
1160164292 18:76496143-76496165 GGGAGGGGAGGGCGGGCGCGCGG + Intronic
1160204385 18:76821690-76821712 GAGGAGGGAAGGAGGGAGAGAGG + Intronic
1160693692 19:472377-472399 GTGAGGGTAAGGCGGGCGAGTGG - Exonic
1160698004 19:494025-494047 AGGTGGGGAAGGCGGGGGTGAGG - Intronic
1160773615 19:844504-844526 GAGAGGGGCAGGCAGGGGAGAGG - Intronic
1160861084 19:1237474-1237496 GGGTGGGGATGGCGAGCCAGGGG + Intronic
1160930150 19:1566610-1566632 GAGGGAGGCAGGCGGGCGGGTGG + Intronic
1161065704 19:2236281-2236303 GAGCGGGGACGGCGGCCGGGAGG - Exonic
1161082227 19:2316984-2317006 GAGAGGGGAAGGGAGGGGAGGGG - Intronic
1161222200 19:3122945-3122967 GTGTGGGGAAGCCGGGGGGGGGG - Exonic
1161400760 19:4065619-4065641 GCGTGGGGGAGGCGGGCGGGCGG - Intronic
1161468912 19:4446792-4446814 GAGTAGGGAATGGGGACGAGGGG - Intronic
1161582885 19:5090515-5090537 GAGCGGGGAAAGAGGGGGAGAGG - Intronic
1161592527 19:5135279-5135301 GTGTGGGGCAGGCGGGCGGGCGG - Intronic
1161725398 19:5925487-5925509 GAGTGGGGAATGAGAGAGAGGGG + Intronic
1161736538 19:5995281-5995303 GAGTGGGACAGGCAGGCCAGAGG - Intronic
1161846342 19:6713732-6713754 GAGTGGGGAAGGTGGGGGGCTGG - Intronic
1161879424 19:6937451-6937473 CGGTGGGGAAGGGGGGAGAGGGG - Intronic
1161946102 19:7438072-7438094 GAGAGGGGAAGGGAGGGGAGGGG - Intronic
1162070452 19:8149377-8149399 GGGTGGAGAAGGCGGGGGCGGGG - Intronic
1162113325 19:8413236-8413258 GATTGGCGAATGCAGGCGAGAGG + Intronic
1162435082 19:10653520-10653542 GGAAGGGGAAGGCGGGCTAGAGG + Intergenic
1162954530 19:14090857-14090879 GAGGGAGGAAGGCGGGCGGCGGG - Intronic
1162982441 19:14248489-14248511 GAGGGGGGCAGGCGGGGGTGGGG - Intergenic
1163490880 19:17616582-17616604 GAGAGGGGACGGCGAGTGAGAGG + Intronic
1164781525 19:30897101-30897123 GAGTGGGGAAGTGGGGTGAAGGG - Intergenic
1165718591 19:38063194-38063216 GAGTGGGGAGGGGGGTGGAGGGG - Intronic
1165840747 19:38788099-38788121 GACTGGGGGAGGCGGGGGGGGGG - Intergenic
1165985790 19:39767751-39767773 GGGTGGGGAAGTTGGGAGAGGGG + Intergenic
1166130891 19:40744850-40744872 GGGGGTGGAAGGCGGGGGAGAGG + Intronic
1166215663 19:41333045-41333067 GAGTGGAGTAGGCGTGAGAGAGG - Intronic
1166222946 19:41377188-41377210 GAGTGGGGCAGGCATGCCAGAGG + Intronic
1166348084 19:42179245-42179267 GAGTGGGGAAGGGAGAGGAGGGG + Intronic
1166765713 19:45251422-45251444 GAGGGGGCAGGGCGGGGGAGGGG - Exonic
1166876680 19:45901927-45901949 GAGTGGGGGCGGGGGGCGGGCGG + Intronic
1167002886 19:46756281-46756303 GAGCTGGGAAGGCGGGCGGCTGG + Exonic
1167264648 19:48477654-48477676 GAGAAGGGAAGGCGGGAGAATGG - Intronic
1167322470 19:48805636-48805658 CAGGGGGGATGGCGGGAGAGGGG - Intronic
1167324093 19:48813361-48813383 GAGGGGGGAAGGAGGTCAAGAGG + Intronic
1167400265 19:49262094-49262116 GAGTGGGGATGATGGGGGAGTGG + Intergenic
1167671753 19:50857503-50857525 GAGTGGGGACCGCTGGGGAGGGG - Intronic
1168072189 19:53959465-53959487 GAGTAGGGAGGGAGGGGGAGGGG - Intergenic
1168276901 19:55283937-55283959 GAGGGGGGAGGGGGAGCGAGGGG - Intronic
1168307422 19:55442985-55443007 GGCTGGGGAGGGCGGGCGGGGGG + Intergenic
1168315596 19:55483481-55483503 CAGTGGGGAAAGCGGGCCAGGGG + Exonic
1168402150 19:56091598-56091620 GAGTGGGGAAGGCAGGAGGTGGG + Intronic
1168524730 19:57079642-57079664 GAGTGGGGAAAGGTGGCCAGTGG + Intergenic
1168562192 19:57393707-57393729 GAGGGGGGAGGGCAGGGGAGGGG + Intronic
924959617 2:22243-22265 GAGGGGGGAGGGCGGGAGAAGGG - Intergenic
925347007 2:3178642-3178664 GGGTGGGGAATGAGGGCCAGTGG - Intergenic
925356741 2:3246963-3246985 GAGAGGGGAAGGAGGGAGGGAGG + Intronic
925371569 2:3349335-3349357 GAGTCGGGGAGGTGGGTGAGTGG - Intronic
925507607 2:4585333-4585355 GAGAGGGGAGGGAGGGAGAGAGG - Intergenic
925913748 2:8589664-8589686 GAGAGGGGAGGGCAGGGGAGGGG + Intergenic
925959753 2:9003734-9003756 GCGCGGGGAAGGCCGGGGAGGGG + Exonic
926972047 2:18475937-18475959 GAGGAGGGAAGGCGGGGGAAGGG + Intergenic
927008814 2:18880499-18880521 GACTGGGGAAGGAGGCTGAGTGG - Intergenic
927156342 2:20223753-20223775 CATTGGGGAAGGCGGGCTAGCGG + Intronic
927596618 2:24403140-24403162 GCGGGGGAAAGGCGGGCGGGGGG - Intergenic
927841585 2:26448504-26448526 GTGGCGGGAAGGCGGGCTAGGGG - Intronic
927971316 2:27307659-27307681 GACTCGGGACGGCAGGCGAGCGG - Exonic
927991881 2:27453850-27453872 GAGTGGGGAAGACAGGAAAGAGG - Intronic
928794235 2:34997324-34997346 GAGTGGGGAGGGGAGGGGAGGGG - Intergenic
930234407 2:48875027-48875049 GAGTGGGGAAGGAAGTTGAGTGG + Intergenic
930624433 2:53680877-53680899 TAGTGGGGATGGGGGGTGAGAGG - Intronic
930711302 2:54553307-54553329 GAGTGGGAGAGGTGGGCAAGAGG + Intronic
930752211 2:54945085-54945107 GAGTGGGAGAGGAGGGAGAGAGG - Intronic
930826315 2:55700276-55700298 GAGTGGGGAGGGGAGGGGAGGGG - Intergenic
931241700 2:60460320-60460342 GAGTGGGGCTGGAGGGCGATGGG + Exonic
931654660 2:64500202-64500224 AAGTAGGGGAGGTGGGCGAGGGG + Intergenic
932239001 2:70142590-70142612 GGGAGGGGAAGGAGGGGGAGGGG - Intergenic
932771310 2:74502301-74502323 CAGTGGGGAACGGGGTCGAGCGG - Intronic
933724936 2:85421245-85421267 GGGTGGGGAAGGTCGGCCAGAGG + Intronic
933747965 2:85584540-85584562 GAGTGGCGAGGGTGGGAGAGAGG + Intronic
934588267 2:95525398-95525420 GAGTGGGGACGGCGGTGGCGGGG - Intergenic
934604352 2:95682768-95682790 GAACGGGGAAGACTGGCGAGGGG - Intergenic
934782212 2:96977938-96977960 GGGTGGGGCGGGCGGGGGAGGGG + Intronic
935874387 2:107490120-107490142 GAGTGGGGAAGGGGAGGAAGGGG + Intergenic
936509928 2:113137179-113137201 CAGAGGGGAAGGAGGGCAAGAGG + Intergenic
936972026 2:118185549-118185571 GAGAGGGCACGGCGGGGGAGGGG + Intergenic
937869350 2:126776652-126776674 CAGCGGGGAAAGCGGGCAAGGGG + Intergenic
938070525 2:128305933-128305955 GAGTGGGGGAGCCAGGCGTGTGG - Intronic
938099593 2:128489720-128489742 GAGAGGAGAAGGGGGCCGAGAGG - Intergenic
938269772 2:129959367-129959389 GAGGAGGGAAGGCGGGAGGGTGG - Intergenic
939606727 2:144262962-144262984 GAGAGGGGAAGGGAGGAGAGGGG + Intronic
940443072 2:153743013-153743035 GAGGGGAGAAGGTGGGGGAGGGG + Intergenic
941904571 2:170708251-170708273 GGCTGGGGAAGGCGGTGGAGAGG - Intergenic
942060747 2:172226596-172226618 GGGTGGAGAAGGCGGGGGCGGGG + Intergenic
942276728 2:174328544-174328566 GGGCAGGGAAGGCGGGCGGGCGG + Intergenic
942313953 2:174682123-174682145 GAGTGGGGACGGGGGTTGAGGGG - Intronic
943622811 2:190168413-190168435 GAGTGGGGAGGGCGGTGGGGGGG - Intronic
943669851 2:190649027-190649049 GCGCGGGGAAGGCAGGGGAGGGG + Intronic
944105594 2:196076130-196076152 GAGAGAGGAAGGGAGGCGAGGGG + Intergenic
944731713 2:202524034-202524056 GAGTGGGGAGAGAGGGAGAGGGG + Intronic
944778981 2:202998224-202998246 GAGTGGGGAGGGTGGGATAGGGG - Intronic
944897211 2:204177521-204177543 GAGTAGGGAAGGAGGGAGGGAGG - Intergenic
945493105 2:210478914-210478936 GAGGGGGGAAGGGGGGAGGGGGG - Intronic
945958061 2:216104890-216104912 GAGTGGGGAGAGAGGGAGAGAGG + Intergenic
946227087 2:218269832-218269854 GAGTGGGGGAGGAGGGGAAGAGG + Intronic
947573116 2:231250765-231250787 GAGTGTGGAAGGAGGGCTGGAGG + Intronic
947636960 2:231685021-231685043 GAGAGGGGAAGGGGGAGGAGCGG + Intergenic
947669170 2:231925871-231925893 GAGCGGCGAAGGCGGCCGCGTGG - Intronic
947860080 2:233352500-233352522 GAGTGTGCAAGGCGGAGGAGGGG - Intergenic
947912339 2:233809540-233809562 GAGTGGGTAAGGCTGGGAAGAGG - Intronic
948145220 2:235703549-235703571 GGGAGGGGAAGGAGGGGGAGGGG - Intronic
948259170 2:236590284-236590306 GAGTGGGTGAGGCAGGAGAGGGG - Intergenic
948440653 2:237985358-237985380 GAGTGGGGAAGGGGGCAGAATGG - Intronic
948768884 2:240237142-240237164 GATTGGGGAAGGCTGGGGGGAGG + Intergenic
948813211 2:240495889-240495911 AAGTGGGGAAGGAGGAGGAGAGG - Intronic
948871948 2:240805098-240805120 GAGAGGGGAGGGAGGGAGAGGGG + Intronic
948884053 2:240874232-240874254 GAGTGGGGAGGCCGGGCGAGGGG + Intronic
948921165 2:241066550-241066572 GAATGGGGAAGGGGTGCTAGAGG + Intronic
1168771132 20:417687-417709 GAGTGGGAAGGGAGGGCCAGAGG - Intronic
1168883388 20:1225987-1226009 GCGTGGAGAAGGCGGGGCAGTGG - Intergenic
1169867653 20:10218374-10218396 GAGAGGGGAAGGCAGAGGAGGGG - Intergenic
1170438346 20:16352732-16352754 GAGCGGGTGAGGAGGGCGAGGGG + Intronic
1170614750 20:17939512-17939534 GAGTGGGGGAGGGCGGGGAGAGG + Intergenic
1170822790 20:19768293-19768315 GAGTGGGGAAAGGGGGCCAGAGG + Intergenic
1170948113 20:20910020-20910042 GAGAAGGGAAGCCGGGAGAGGGG + Intergenic
1171144596 20:22770637-22770659 GAGTGAGGAAGCTGGGCCAGAGG - Intergenic
1171191889 20:23164739-23164761 GAGTGTGGGAGGAGGGAGAGCGG - Intergenic
1172113977 20:32563041-32563063 GAGAGTGGAAGGAGGGAGAGTGG + Intronic
1172202395 20:33135712-33135734 GAATGGGGAAGGGGAGTGAGGGG + Intergenic
1172460285 20:35112956-35112978 GAGTGGGAAAGGAGGGAGGGAGG + Intergenic
1172650632 20:36499371-36499393 GAGGCGGGCAGGCGGGCGGGCGG - Intronic
1172740679 20:37164232-37164254 GAGAAGGGAAGGAGGGAGAGAGG - Intronic
1172852581 20:37977310-37977332 GAGTGGGGGAGACGGGGGCGGGG + Intergenic
1172970895 20:38872398-38872420 GAGCGGGAAAGGAGGGAGAGAGG + Intronic
1173019267 20:39253548-39253570 GGCTGGGGGAGGAGGGCGAGAGG + Intergenic
1173162845 20:40664908-40664930 TTGGGGGGAAGGCGGGGGAGGGG + Intergenic
1173279794 20:41618155-41618177 GAGCGGGGCCGGCGGGCGGGCGG - Intronic
1173313074 20:41917682-41917704 GAGTGGGGAAGGGGGAGGGGAGG + Intergenic
1173355776 20:42288507-42288529 AAGTGGGGAAAGAGGGAGAGAGG - Intronic
1173631618 20:44520602-44520624 GAGTGGGGAAGGACGGTGGGGGG + Intronic
1174147067 20:48459377-48459399 CAGTAGGGCAGGCAGGCGAGAGG + Intergenic
1174298970 20:49568356-49568378 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
1174317116 20:49712452-49712474 GCTTGGGGCAGGCGGGGGAGGGG + Intronic
1174351838 20:49974231-49974253 AAGAGGGGAAGGCGTGCCAGAGG + Intergenic
1174763499 20:53229760-53229782 GAGGGGGAAAGGAGGGAGAGAGG + Intronic
1175104241 20:56603168-56603190 AAGTGGGGAAGGCAGGTGAGTGG - Intergenic
1175245203 20:57578027-57578049 GGGTGGGGAAGGGGAGAGAGGGG + Intergenic
1175491726 20:59384512-59384534 GAGTGGGGAAGTGGTGAGAGGGG + Intergenic
1175745200 20:61451694-61451716 GAGAGGGGAAGGAGGAGGAGGGG + Intronic
1176052966 20:63130281-63130303 GAGTGGGGGAGGGGAGGGAGCGG - Intergenic
1176052975 20:63130298-63130320 GAGGAGGGGAGGAGGGCGAGTGG - Intergenic
1176083717 20:63286474-63286496 GAGTGGCCAAGGCAGGGGAGTGG - Intronic
1176110833 20:63409974-63409996 GAGGGGGGAGGGTGGGCCAGGGG + Intronic
1176625567 21:9088424-9088446 CAGTGGGGAAGCCGGGCCTGGGG - Intergenic
1177758356 21:25373813-25373835 GGGAGGGGAAGGAGGGGGAGGGG - Intergenic
1179005234 21:37508072-37508094 GTGTGGGGAAAGAGGGAGAGAGG - Intronic
1179308066 21:40172875-40172897 GAGTTGGGTGGGTGGGCGAGAGG + Intronic
1179713259 21:43274999-43275021 GAGTGGGGAGGTGGGGGGAGAGG - Intergenic
1180599551 22:17007411-17007433 GAGGAGGGAAGGGGAGCGAGCGG + Intronic
1181052792 22:20245667-20245689 GAGAGAGAAAGGTGGGCGAGAGG - Intronic
1181162729 22:20967494-20967516 GAGAGGGGAAGGGGGGCACGAGG + Intronic
1181186173 22:21105988-21106010 GAGAGGGGAAGGAGGGGGATAGG - Intergenic
1181319112 22:21991058-21991080 GACTGGGGAAGGGGAGCGAGAGG + Intergenic
1181539615 22:23566349-23566371 GAGAGGGGAGCGCGGGCGAGAGG + Intergenic
1183097983 22:35565768-35565790 TGGTGGGGTAGGCGGGTGAGAGG - Intergenic
1183248350 22:36710994-36711016 GAGGGAGGAAGGCAGGAGAGTGG - Intergenic
1183305956 22:37083354-37083376 GAGTGGGGAGGGTGGGCAAGGGG - Intronic
1183332565 22:37229279-37229301 GAGAGGGCAAGGAGGGTGAGGGG + Intronic
1183510585 22:38232462-38232484 GTGTGGAGAAGGCGGGGGAAGGG + Intronic
1183512835 22:38245897-38245919 GAGTGGGGAGGGCTGGCGGGGGG - Intronic
1183541411 22:38431323-38431345 GAGTGGGCACTGCTGGCGAGGGG - Intronic
1183615802 22:38944663-38944685 GAGAGGGGAAGGAGGGCAAAAGG - Intergenic
1184100336 22:42338564-42338586 GAGGCGGGGAGGCTGGCGAGAGG + Intronic
1184414362 22:44343634-44343656 CAGTGAGGAAGGTTGGCGAGGGG + Intergenic
1184423373 22:44394903-44394925 GAGTGGGGAAGGGTGGAGGGGGG + Intergenic
1184498818 22:44859837-44859859 GAGTGGGGAAGGGGGGAGCTTGG + Intronic
1184500006 22:44865769-44865791 GAGTGGGCAAGGGGGGCGCTTGG - Intergenic
1184512259 22:44940592-44940614 GGGTGGGGAAGGATGGGGAGAGG + Intronic
1184663784 22:45977219-45977241 GAGCGAGGAGGGCGGGCGGGAGG - Intergenic
1184888653 22:47366219-47366241 GTGTGGGGAAGGCGGTGGGGTGG + Intergenic
1185345196 22:50307787-50307809 GAGAGGGGGAGGGGGGAGAGGGG + Intergenic
949987947 3:9554082-9554104 GAGTGGGGAAGGAGCTGGAGGGG + Intergenic
950153849 3:10708060-10708082 GAGGGAGGGAGGCGGGCGGGCGG - Intergenic
950884725 3:16353317-16353339 GAGAGGGGCAGGCAGGAGAGGGG + Intronic
951080505 3:18445373-18445395 GAGGGGCGAGGGCGGGCCAGGGG + Intronic
952449127 3:33414282-33414304 GAGGGAGGAGGGCGGGAGAGAGG + Intronic
952686050 3:36149415-36149437 GAGTGGGGAAGGAGAGGAAGGGG + Intergenic
952772402 3:37014173-37014195 GAGTAGGGTAGGTGGGTGAGTGG + Intronic
952942476 3:38454700-38454722 GCGTGGGGAAGGCGGCCAAGAGG + Intronic
953181317 3:40597602-40597624 CAGTGGGGAAGGGAGGCAAGAGG + Intergenic
953348460 3:42195997-42196019 GAGTGGGGAAGGCAGTGGAGTGG - Intronic
953561158 3:43995017-43995039 GAGTGGGGGACCCGGGCGGGAGG + Intergenic
954459234 3:50617094-50617116 GAGTGGGGGAGGGGGGGGTGGGG + Intronic
954655733 3:52193087-52193109 GAGGGTGGCAGGCGGGCGAGTGG - Intergenic
954839271 3:53496069-53496091 AAGAGGGCAAAGCGGGCGAGCGG - Intronic
955072439 3:55583442-55583464 GAGAGGGGAAGGAGGGAGGGAGG - Intronic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
955412895 3:58667355-58667377 GAGTGAGGAAGATGGGGGAGAGG + Intergenic
955499564 3:59570505-59570527 GCGTGAGGGAGGAGGGCGAGGGG - Intergenic
956084637 3:65597067-65597089 GGCTGGGGAAGGCAGGGGAGAGG - Intronic
956308580 3:67853806-67853828 GAATGGGGAAGGCGAAGGAGGGG + Intergenic
959124094 3:102269069-102269091 GAGTGGGGAAGATGGGCAATTGG + Intronic
959902287 3:111674545-111674567 GAGCAGGGAAGGCGTGGGAGCGG + Intergenic
960773885 3:121226605-121226627 GACTGGGGAAAGAGGGCTAGGGG + Intronic
961994383 3:131226096-131226118 GAGTGGGGAAAGAGGGAGAATGG + Intronic
963183059 3:142380891-142380913 GAGAGGCCAAGGCGGGCGTGGGG - Intronic
965544357 3:169900126-169900148 GTGTGGGGAAGGGTGGGGAGAGG + Intergenic
966461394 3:180180601-180180623 GAGGGGGGAAGGAGGGAGTGAGG + Intergenic
966554668 3:181245372-181245394 GTGTGGGGATGGGGAGCGAGGGG + Intergenic
966594585 3:181713602-181713624 GGGTGGGGAGGGCGGGGGAATGG + Exonic
966695349 3:182784646-182784668 GAGAGGGGAAGATGGGGGAGGGG - Intergenic
966916575 3:184587562-184587584 GGGTGGGGCAGACGGGCAAGGGG + Intronic
967317338 3:188161707-188161729 GAGTGGGGAAGGAAGGTGTGAGG - Intronic
967387707 3:188927620-188927642 AAGTGGGGAAGGGGGAGGAGGGG - Intergenic
967849535 3:194071397-194071419 GCGTGGGGAAGGCGGGAAGGCGG - Intergenic
967915130 3:194572982-194573004 GTGTGGGCAAGGTGGGCGAAGGG - Intergenic
967986877 3:195101812-195101834 GAGAGGGGAAGGGAGGGGAGGGG + Intronic
968454415 4:689637-689659 GCATGGGGTAGGAGGGCGAGGGG + Intergenic
968469144 4:770295-770317 GAGTGGGGAGGGCTGGGGTGAGG - Exonic
968584144 4:1408121-1408143 CAGCGGGGAGGGCGGGGGAGGGG - Intergenic
968616386 4:1579425-1579447 GAGTGCGGAGGGCGGGGGGGTGG - Intergenic
968925577 4:3545556-3545578 GAACGGGGATGGCCGGCGAGGGG + Intergenic
969352021 4:6603532-6603554 GAGTGGGGAAGGGGTGTGTGTGG - Intronic
969365974 4:6694493-6694515 GAGCAGGGAAAGCGGGCAAGTGG - Intronic
969370325 4:6727657-6727679 GAGAGGGGGAGGAGGGGGAGGGG - Intergenic
969491107 4:7499714-7499736 GAGCGAGGAAGGCAGACGAGAGG - Intronic
970918641 4:21366804-21366826 GAGAGGGGAGGGAGGGAGAGAGG + Intronic
971260202 4:25050059-25050081 GAGTGGGCAGGGAGGCCGAGGGG + Intergenic
972813353 4:42614813-42614835 GAGTGGGAAAGGAGGAAGAGGGG - Intronic
973246437 4:48015883-48015905 GAGTGGGCAGGGCTGGCGGGTGG - Intronic
973771487 4:54211187-54211209 GAGTGTGGAAGGGGCGTGAGTGG + Intronic
974482963 4:62470260-62470282 GAGGGGGGAAGGGGGGAGGGGGG - Intergenic
974762834 4:66300686-66300708 GAGAGGGGAAGGGAGGAGAGGGG - Intergenic
974849273 4:67385621-67385643 GAGGGGGGAAGGAGGGGGAGGGG + Intergenic
976018965 4:80596082-80596104 GATTGGAGAAGGAGGGAGAGAGG + Intronic
976052951 4:81030526-81030548 GGGTGGGGATGGCTGGGGAGAGG - Intergenic
976350175 4:84051862-84051884 GAGTGAGGAAGAGGGGCGGGTGG + Intergenic
976614010 4:87057895-87057917 GGGTGGGGATGGTGGGCGGGGGG - Intronic
976744823 4:88392113-88392135 GAGAGGGGAAGGGAGGGGAGAGG - Intronic
977058782 4:92229314-92229336 GAGGGGGGAAGGTGGGAGGGGGG + Intergenic
978297283 4:107220570-107220592 GAGTGGGGAAGGAGGGAGGGAGG + Intronic
978822324 4:112980103-112980125 GAGTGTGGAAGAGGGGCCAGGGG - Intronic
981076836 4:140600862-140600884 GAGAGGGGAAGACGGTCTAGGGG + Intergenic
982117483 4:152109538-152109560 GAGTCGGGAGGGAGTGCGAGGGG + Intergenic
982117930 4:152113394-152113416 GAGTGGGGAAGGAGGAGGAGAGG + Intergenic
983155055 4:164336998-164337020 GAGGAGGGAAGGAGGGAGAGGGG + Intronic
983338638 4:166428620-166428642 GAGTGGGGGAAGAGGGAGAGAGG - Intergenic
983999592 4:174224820-174224842 GAGAGGGGAAGGGAGGGGAGGGG - Intergenic
984628941 4:182039987-182040009 GGGAGGGGAAGGCAGGGGAGGGG + Intergenic
984806793 4:183758551-183758573 GCGTGGGGAAGGCTGGGGACAGG + Intergenic
984911202 4:184676294-184676316 GGGAGGGGAAGGCAGGGGAGGGG - Intronic
985137477 4:186801746-186801768 GAGTGGGGGTGGTGGGAGAGAGG + Intergenic
985295218 4:188430648-188430670 GAGTGGGGAAGGCTTGCCTGTGG - Intergenic
985443972 4:190009397-190009419 GAGCGGGGAAGGTGGGAGAAGGG + Intergenic
985671759 5:1210377-1210399 GAGTGGGGATGGGTGGCCAGTGG + Intronic
986681960 5:10241469-10241491 GAGTGGGGGATGCTGGCGATTGG - Intronic
986772595 5:10987664-10987686 GAGTGGGGAGGGGAGGAGAGGGG - Intronic
987880433 5:23737262-23737284 GAGTGGGGAGGACAGGAGAGGGG - Intergenic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
990589656 5:57249775-57249797 GAGGGGGGAAGGAGGGGAAGGGG - Intronic
992312085 5:75511392-75511414 GAGCGAGGAAGGAGGACGAGCGG + Exonic
992527873 5:77629839-77629861 GAGGGGAGGCGGCGGGCGAGGGG + Exonic
992655777 5:78908273-78908295 GAGAGTGGAAGTCGGGGGAGGGG - Intronic
992986890 5:82239551-82239573 TAGTGGTGAAGGAGGGAGAGAGG + Intronic
993085771 5:83361938-83361960 GAGAGGGGAAGGAGGGACAGAGG - Intergenic
994451106 5:99945497-99945519 GAGTGGGGCGGGCGGGCGGGGGG - Intergenic
994608160 5:101997549-101997571 GAGTTGGGAAGGAGGGAGGGAGG - Intergenic
994618865 5:102138796-102138818 GAGTGGGGAGGGTGGGAGAAGGG - Intergenic
994768603 5:103953890-103953912 GAGGGGGGGAGGGGTGCGAGGGG + Intergenic
994943033 5:106349397-106349419 GAGAGGGGAAGGGAGGGGAGGGG + Intergenic
994954423 5:106510183-106510205 GAGAGGGGAGGGCAGGGGAGGGG - Intergenic
995123785 5:108560124-108560146 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
996831241 5:127742984-127743006 GAGTTGGGAAGGGTGGAGAGTGG - Intergenic
997455600 5:134015209-134015231 GAGAGGGGAGGGAGGGAGAGAGG + Intergenic
997649830 5:135508152-135508174 AAGAGGGGAAGGAGGGCGGGAGG + Intergenic
998022057 5:138777911-138777933 GAGAGGGGGAGGAGGGAGAGGGG + Intronic
998022064 5:138777926-138777948 GAGAGGGGGAGGAGGGAGAGGGG + Intronic
998022071 5:138777941-138777963 GAGAGGGGGAGGAGGGAGAGGGG + Intronic
998093908 5:139386561-139386583 GACTGGGGATGGGGGGTGAGGGG - Intergenic
998127004 5:139631038-139631060 AAGTGGGGAAGGAGGGAGGGAGG - Intergenic
998135079 5:139670192-139670214 GCGTGGGGGAGGCAGGCGAGAGG - Intronic
998804058 5:145901146-145901168 GAGGGGGGAAGGAGGGAGGGGGG + Intergenic
999275124 5:150325099-150325121 GAGTGGGGAGGGAGGGAGAAAGG + Intronic
999379132 5:151108204-151108226 GACTGGGGCAGGCAGGGGAGGGG - Intronic
999616492 5:153430253-153430275 GAGTGGGGAAGGGTGGGGAGGGG + Intergenic
1000990649 5:167908369-167908391 GAGAGGGGAAGGGAGGGGAGAGG - Intronic
1001525485 5:172425709-172425731 GGGTGGGGGAGGCGTGCGACAGG + Intronic
1001653332 5:173330016-173330038 GAGTGGGGAAGGCGGAGGCGGGG + Intergenic
1002048715 5:176556935-176556957 GAGCGGGGAAGGGGAGGGAGGGG - Intronic
1002184347 5:177447250-177447272 GAGGGGGGAGGGAGGGGGAGGGG - Intronic
1002377014 5:178796072-178796094 AAGTGGGGAGGGAGGACGAGTGG + Intergenic
1002455989 5:179345542-179345564 GAGGGAGGGAGGCGAGCGAGGGG + Intergenic
1002664080 5:180810165-180810187 GAGGGGGGAAGGAGTGCGAGGGG - Intronic
1002697081 5:181098537-181098559 GGGAGGGGAGGGCAGGCGAGGGG + Intergenic
1002697099 5:181098572-181098594 GGGAGGGGAGGGCAGGCGAGGGG + Intergenic
1002697134 5:181098637-181098659 GGGAGGGGAGGGCAGGCGAGGGG + Intergenic
1002697174 5:181098712-181098734 GGGAGGGGAGGGCAGGCGAGGGG + Intergenic
1002697183 5:181098732-181098754 GGGAGGGGAGGGCAGGCGAGGGG + Intergenic
1002697189 5:181098747-181098769 GCGAGGGGAGGGCAGGCGAGGGG + Intergenic
1002697631 5:181101022-181101044 GGGTGGGGAGGGGTGGCGAGGGG - Intergenic
1002774955 6:320704-320726 CAGTGGGGAGGGAGGGTGAGGGG + Intronic
1003518468 6:6837119-6837141 GGGTGGGGTAGGAGGGAGAGGGG + Intergenic
1004009064 6:11663917-11663939 GTGTAGGGGAGGCGGGCGGGGGG + Intergenic
1004072590 6:12314512-12314534 GGGTGGGGAAGGAGGGAGTGAGG - Intergenic
1004562203 6:16761324-16761346 GCGTGGGGAAGGGGGGGCAGAGG + Exonic
1005252682 6:23965463-23965485 AAGTAGGGAAGGTGGGAGAGAGG - Intergenic
1005826290 6:29633179-29633201 GAGAGGGGAAGACCGGGGAGAGG + Exonic
1005968301 6:30742637-30742659 GGGTGGGGAACGCGGGAGCGGGG - Exonic
1006122247 6:31814684-31814706 GAATGGGGGAGGCGGGGGAAGGG - Intronic
1006197571 6:32255199-32255221 GAGAGGAGAAGGGGCGCGAGGGG + Intergenic
1006271336 6:32969198-32969220 GAGCGTGGAGGGGGGGCGAGCGG + Intronic
1006373223 6:33658033-33658055 GAGAGGGGCAGGCGGGAGAGAGG - Intronic
1007076958 6:39074246-39074268 CAGTGGGGCAGGGGGGCCAGAGG + Intronic
1007791519 6:44311560-44311582 GGGGGGGGAAGACGGGTGAGAGG + Intronic
1008081558 6:47200086-47200108 GAGTGGGGAAGGAGGGAGTGGGG - Intergenic
1008449058 6:51628219-51628241 GAGTGGGGAAGGTGGGAGGGGGG - Intronic
1008788907 6:55204761-55204783 GGGAGGGGAAGGCAGGGGAGAGG - Intronic
1008998404 6:57685475-57685497 GTCGGGGGAAGGCGGGCAAGGGG + Intergenic
1009450468 6:63794069-63794091 GAGTGCTGAAGGTGGGAGAGAGG - Intronic
1011194044 6:84764190-84764212 GAGAGGGGCGGGCGGGCGCGGGG - Exonic
1011474431 6:87736904-87736926 GAGGGGGGAGGGAGGGGGAGGGG + Intergenic
1011756859 6:90508888-90508910 TAGTGTGGAAGGCTGGCCAGGGG + Intergenic
1011970061 6:93211439-93211461 GAGTGGGGAAGTGGGGAAAGGGG + Intergenic
1014363301 6:120507577-120507599 GACTGGGGAAAGAGGGTGAGTGG + Intergenic
1015657951 6:135540970-135540992 GAGTGGGAAAGGCAGCTGAGTGG + Intergenic
1015773580 6:136792410-136792432 GGGTGGGGAAGCCGGGTGAGCGG + Exonic
1016403012 6:143700561-143700583 CAGTGGGGAGGGGGGGCGAGAGG + Intronic
1016448390 6:144156060-144156082 GAGTGGGGAGGGGAGGGGAGGGG - Intronic
1017637381 6:156456235-156456257 GGGAGGGGAAGGGGGACGAGGGG - Intergenic
1017662476 6:156687636-156687658 GAGTGAGGGACGCGGGAGAGGGG - Intergenic
1017729574 6:157303251-157303273 GAGTGAGTAAGGCTGGGGAGTGG + Intronic
1017788298 6:157774236-157774258 GAGTGGAGGAGGTGGGGGAGTGG + Intronic
1018095539 6:160384480-160384502 GGGTGAGGAAGGCGGGAGACAGG + Intronic
1018837214 6:167494116-167494138 GGGCGGGGAAGGCGGGAGAAGGG + Intergenic
1019320670 7:414115-414137 GAGTCGGGGAGGAGGGGGAGAGG - Intergenic
1019442266 7:1053298-1053320 GTGTGGCGACGGCGGGGGAGGGG + Intronic
1019478688 7:1256161-1256183 GCGTGGGGAAGGCGGGAGGCTGG - Intergenic
1019600791 7:1882741-1882763 GCGGTGGGAAGGGGGGCGAGGGG - Intronic
1019618106 7:1975732-1975754 GAGTGGGGACCTCGGGTGAGTGG + Intronic
1019825277 7:3279394-3279416 GAGAGAGGAAGGAGGGAGAGAGG + Intergenic
1020240393 7:6389999-6390021 GAGGAGGGAAGGAGGGAGAGAGG - Intronic
1021633011 7:22665211-22665233 GAGGCGGGGAGGTGGGCGAGCGG - Intergenic
1021862821 7:24923731-24923753 CAGTGGGGCAGGCGGGCGGCCGG + Intronic
1021868149 7:24979400-24979422 GGGTTGGGAAGGCGGGCGAGCGG + Intronic
1022923205 7:35037006-35037028 GAGAGGGGAAGGAAGGGGAGGGG + Intronic
1023638599 7:42237145-42237167 GCGCGGGGAAGGCGGGAGAGCGG + Intronic
1024577116 7:50773456-50773478 GGGAGGGGAAGGCAGGGGAGGGG + Intronic
1024577123 7:50773471-50773493 GGGAGGGGAAGGCAGGGGAGGGG + Intronic
1026003629 7:66582858-66582880 GAGTGGCGAAGGCAAGGGAGAGG + Intergenic
1026743740 7:72995361-72995383 GAGAGGGGAAGGGAGGGGAGGGG + Intergenic
1026803654 7:73416032-73416054 GAGAGGGGAAGGGAGGAGAGGGG + Intergenic
1027099995 7:75369716-75369738 GAGAGGGGAAGGGAGGGGAGGGG - Intergenic
1027404604 7:77846591-77846613 GGGAGGGGAAGGGAGGCGAGGGG - Intronic
1027941781 7:84691479-84691501 GAGTGGAGAAGGAGGGAGAATGG - Intergenic
1029443826 7:100602283-100602305 CAATGGGGAAGGCGGGACAGTGG - Exonic
1029578962 7:101422429-101422451 AAGTGGGGAAGGCAGGGGATAGG - Intronic
1029629100 7:101739404-101739426 GGGTGGGGAAGGTGAGGGAGAGG + Intergenic
1029666301 7:101997208-101997230 GAGTGGGGAAAGCGGTAGTGTGG + Intronic
1031025229 7:116672346-116672368 GAGTGCGGCCGGCGGGCGGGCGG + Intergenic
1031214854 7:118877228-118877250 GGGAGGGGAAGGAGGGGGAGGGG + Intergenic
1032078146 7:128845838-128845860 GAGTGGGAGAGGAGGGGGAGAGG + Intronic
1032078168 7:128845904-128845926 GAGAGGGAAAGGAGGGGGAGAGG + Intronic
1032236910 7:130132559-130132581 GAGTGAGGAATGTGGGAGAGAGG + Exonic
1033425389 7:141239311-141239333 GAGGGAGGAAGGCAGGGGAGCGG + Intronic
1034117474 7:148596791-148596813 GAGTGGGGAAGGAGGAAGGGAGG - Intronic
1034263985 7:149772774-149772796 GAGTGTGGGAGGGGGCCGAGGGG - Intronic
1034418597 7:150977813-150977835 GAGTGGGGGAGGGGGCTGAGCGG - Intronic
1034563255 7:151894885-151894907 GAGCGGGGAGGGCGGAGGAGCGG - Intergenic
1034563262 7:151894902-151894924 GAGCGGGGAGGGCGAACGAGCGG - Intergenic
1034563277 7:151894953-151894975 GAGCGGGGAGGGCGAACGAGCGG - Intergenic
1034563330 7:151895140-151895162 GAGCGGGGAGGGCGGAGGAGCGG - Intergenic
1034566759 7:151921668-151921690 GAGCGGGGAATGCTGGGGAGTGG + Intergenic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035609070 8:948400-948422 GAGTGGGCGAAGCGGGCGACAGG + Intergenic
1036495117 8:9263252-9263274 GAGAGGGGAGGGAGGGAGAGAGG + Intergenic
1037085774 8:14847724-14847746 GAGGGAGGGAGGCGGGAGAGAGG + Intronic
1037911528 8:22746569-22746591 GAGGGGGAGAGGCGGGAGAGAGG - Intronic
1038002454 8:23403542-23403564 GAGTGGGGCACGCGGGGGACGGG - Intronic
1038176267 8:25184459-25184481 GGGTGGGGAGGGCGGGAGAAAGG + Intergenic
1038531341 8:28320288-28320310 GAATGGGGAAGGAGGGTGGGGGG - Intronic
1038645808 8:29361269-29361291 GGGTGGGGAAGGTGGGGGATTGG - Intergenic
1038660569 8:29493153-29493175 GAGTGGAGGAGGCAGGCCAGTGG - Intergenic
1038779299 8:30556879-30556901 GAGTGGGGAAGATGGGGGTGAGG - Intronic
1039379831 8:37074705-37074727 GAGAGAGGAAGGCGGGTTAGTGG - Intergenic
1040629260 8:49190797-49190819 GAGTGGGGAGGGAGGGAGGGAGG - Intergenic
1040664161 8:49612065-49612087 GAGTGGGGTGGGCGGGGGGGTGG - Intergenic
1040917213 8:52574557-52574579 GAGGGGAGAAGGAGGGGGAGGGG + Intergenic
1041214203 8:55583680-55583702 AAGTGGGGAAGGCAGGAGAGGGG + Intergenic
1041636664 8:60153110-60153132 GAGGGGGGAAGGGGGGTGCGGGG + Intergenic
1041922509 8:63198253-63198275 GAGAAGGGAAGGTGGGGGAGTGG - Intronic
1042591623 8:70403123-70403145 GAGAGTGGGAGCCGGGCGAGGGG - Intronic
1043141976 8:76602035-76602057 GAGTGGGGGAGGCAGAGGAGGGG + Intergenic
1043388107 8:79767854-79767876 GAGTGGGGAAGGCGGGCGAGGGG + Exonic
1043918685 8:85955259-85955281 GAGTGGAGAAGGAGGGAGGGGGG + Intergenic
1043941941 8:86205642-86205664 GAGTGGGGAGGGGAGGGGAGTGG + Intergenic
1044175975 8:89123111-89123133 GAGTGGGGAAGGCAGCAGTGAGG - Intergenic
1044593372 8:93935358-93935380 GGGTGGGGTAGGCGGGAGTGGGG + Intergenic
1045279643 8:100738954-100738976 GAGTTGGGAAGGCGAGCCAGAGG - Intergenic
1045326713 8:101122742-101122764 GGGAGGGGAAGGCAGGGGAGGGG + Intergenic
1045496323 8:102712491-102712513 TAGTGGGGATGGTGGGCGGGGGG - Intergenic
1045879566 8:107021759-107021781 GAATGGGGAGGGTGGGAGAGAGG + Intergenic
1046032278 8:108797543-108797565 TAGTGGGGAAGGATGGGGAGGGG - Intergenic
1047026898 8:120834115-120834137 GGGTGGGGAAGGCGGCCAGGAGG + Intergenic
1048519669 8:135141939-135141961 GAGTGGGGAAAGGGAGAGAGAGG + Intergenic
1048526101 8:135204437-135204459 GAGTGGGGAGGGCAGGAGAGGGG + Intergenic
1049155988 8:141067178-141067200 GAGTGGGGCAGGTGGGACAGAGG + Intergenic
1049541651 8:143211599-143211621 CAGTGGGGGAGGCGGGGCAGTGG + Intergenic
1049541676 8:143211650-143211672 CAGTGGGGGAGGCGGGGCAGTGG + Intergenic
1049541684 8:143211667-143211689 CAGTGGGGGAGGCGGGGCAGTGG + Intergenic
1049664278 8:143836076-143836098 CCGTGGGGAAGGCGGGAGCGTGG - Intronic
1049718169 8:144103528-144103550 GAGTGGGGGCGGAGGGCGCGCGG - Intronic
1051334564 9:16054517-16054539 TAGTGGGGAAGGCAGGGGAGAGG - Intronic
1054460266 9:65458723-65458745 GTGTGAGGCAGGCGGGAGAGGGG - Intergenic
1057013885 9:91633120-91633142 GAGAGGGGAAGGGAGGGGAGGGG + Intronic
1057490128 9:95513998-95514020 GGGTGGGGAAAGCGGCAGAGGGG + Intronic
1059191769 9:112333658-112333680 GGGTGGGGAAGGCGGGGGCGCGG - Intronic
1059438656 9:114290582-114290604 GAGTGAGGAAGGGGCGGGAGAGG - Intronic
1059632712 9:116141917-116141939 GAGAGGGGAAGGGAGGGGAGGGG + Intergenic
1060254397 9:122014473-122014495 GAGTGGGGAAGGTGGGAAGGTGG - Intronic
1060283265 9:122227950-122227972 GAGTGGGGTGGGGGGGCGGGTGG - Intronic
1060735740 9:126065568-126065590 GAGGGGGGAAGGAGGGAGGGAGG - Intergenic
1061127990 9:128689011-128689033 GAGAGGGGAGAGCGGGGGAGGGG + Intronic
1061275769 9:129568831-129568853 GAGAGGGGAGCGCGGGCGGGAGG + Intergenic
1061339221 9:129965794-129965816 GAGGGGGGAAGGAGGGAGGGAGG + Intronic
1061840649 9:133356786-133356808 GAGAGGGGAGGGCAGGGGAGAGG + Intronic
1061900091 9:133668471-133668493 GAGGGGAGAGGGAGGGCGAGGGG - Intronic
1062010894 9:134266130-134266152 CAGCAGGGAAGGCGGGCAAGGGG + Intergenic
1062150145 9:135013955-135013977 GAGCGGGGGAGGCGGGAAAGGGG - Intergenic
1062194138 9:135263893-135263915 GAGAGGGGAAGGAGGAGGAGAGG - Intergenic
1062450642 9:136614370-136614392 GGGTGGGGAAGGCGGGAGCCGGG - Intergenic
1062500071 9:136848467-136848489 GGGTGGGGTATGCGGGAGAGGGG + Exonic
1062533916 9:137013377-137013399 TGGTGGGCCAGGCGGGCGAGGGG - Intronic
1062715202 9:138006714-138006736 GTGTGGGGAAGGCGGCCATGGGG + Intronic
1203748736 Un_GL000218v1:58885-58907 CAGTGGGGAAGCCGGGCCTGGGG - Intergenic
1185462183 X:338530-338552 GAGTGGGGAGGACGGGTGAGTGG - Intronic
1185462201 X:338579-338601 GAGTGGGGAGGACGGGTGAGTGG - Intronic
1185511422 X:667791-667813 GAGTGGGGAGGGCAGGGGAGGGG - Intergenic
1185644209 X:1605564-1605586 CAGAGGGGAAGCTGGGCGAGAGG - Intergenic
1185648007 X:1628774-1628796 GGGAGGGGAAGGGAGGCGAGAGG - Intronic
1185662042 X:1735632-1735654 GAGGGGGGAAGGAGGGGGAGGGG - Intergenic
1186001253 X:5013683-5013705 GAGTGAGGAAGGATGGGGAGAGG + Intergenic
1186367096 X:8906998-8907020 GAGTGAGGTAGGCTGGCGAGAGG + Intergenic
1186737506 X:12481246-12481268 GAGTGGGGAAGTAGAGGGAGTGG - Intronic
1186795667 X:13044497-13044519 ATGCGGGGAAGGCGGGCCAGAGG - Intronic
1186935146 X:14441587-14441609 GGGTGGGGGACGCGGGGGAGGGG + Intergenic
1187686021 X:21816406-21816428 GTGTGGGGTGGGAGGGCGAGGGG - Intergenic
1189281392 X:39821860-39821882 GAGAGGGGAACTCGGGCGCGGGG - Intergenic
1189333330 X:40155846-40155868 GGGTGGGGAGGGGGGGCGCGCGG + Intronic
1189733365 X:44045207-44045229 GAGTGGGGAGGGGAGGCCAGAGG - Intergenic
1190184352 X:48221761-48221783 GAGAGGGGGAGGGGGGGGAGGGG - Intronic
1190214497 X:48470562-48470584 GGGGTGGGCAGGCGGGCGAGGGG - Intergenic
1190388778 X:49911320-49911342 GAATAGGGAAGGTGGGTGAGAGG - Intergenic
1190497021 X:51036518-51036540 GAATGGGGAGGGTGGGAGAGGGG - Intergenic
1190508965 X:51157599-51157621 GAATGGGGAGGGTGGGAGAGGGG + Intergenic
1190715018 X:53095902-53095924 GAGTGAGCAAGGGGGGAGAGTGG - Intergenic
1190726330 X:53193023-53193045 GAGTGGAGAAAGGGGCCGAGGGG + Exonic
1191641636 X:63433598-63433620 GAGTGGGGCTGGGGGGCGGGTGG + Intergenic
1191838242 X:65488392-65488414 GGGTGGGGTAGGGGGGCGACAGG + Intronic
1194320433 X:92440300-92440322 GAGTGGGGAGGGAGGGAGGGAGG - Intronic
1195299088 X:103509504-103509526 GAGAGGGGAGGGAGGGAGAGGGG - Intronic
1196288851 X:113915413-113915435 GAGAGGGGAGGGCAGGGGAGGGG - Intergenic
1197215188 X:123860326-123860348 GAGAGGGGAAGGAGGGAAAGCGG - Intronic
1198051425 X:132956535-132956557 GTGCGGGGGAGGCGGCCGAGCGG - Intronic
1200418154 Y:2935070-2935092 TAGTGGTGACGGCGGGCGCGCGG + Intronic
1201146225 Y:11066906-11066928 GAGAGAGGAAGGTGGGAGAGAGG + Intergenic
1201162093 Y:11173854-11173876 CAGTGGGGAAGCCGGGCCTGGGG - Intergenic