ID: 1043390892

View in Genome Browser
Species Human (GRCh38)
Location 8:79790639-79790661
Sequence AGGCCTACTCAAATGAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043390892_1043390897 13 Left 1043390892 8:79790639-79790661 CCTTGGTTCATTTGAGTAGGCCT No data
Right 1043390897 8:79790675-79790697 GAAAAAACATCGGCCGGGCATGG No data
1043390892_1043390896 8 Left 1043390892 8:79790639-79790661 CCTTGGTTCATTTGAGTAGGCCT No data
Right 1043390896 8:79790670-79790692 AGTAAGAAAAAACATCGGCCGGG No data
1043390892_1043390894 3 Left 1043390892 8:79790639-79790661 CCTTGGTTCATTTGAGTAGGCCT No data
Right 1043390894 8:79790665-79790687 GACAAAGTAAGAAAAAACATCGG No data
1043390892_1043390898 16 Left 1043390892 8:79790639-79790661 CCTTGGTTCATTTGAGTAGGCCT No data
Right 1043390898 8:79790678-79790700 AAAACATCGGCCGGGCATGGCGG No data
1043390892_1043390895 7 Left 1043390892 8:79790639-79790661 CCTTGGTTCATTTGAGTAGGCCT No data
Right 1043390895 8:79790669-79790691 AAGTAAGAAAAAACATCGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043390892 Original CRISPR AGGCCTACTCAAATGAACCA AGG (reversed) Intergenic
No off target data available for this crispr