ID: 1043390976

View in Genome Browser
Species Human (GRCh38)
Location 8:79791321-79791343
Sequence GTGGCTTCACTTGGATACAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1043390970_1043390976 6 Left 1043390970 8:79791292-79791314 CCATCAGTCTTTGGACCAACCTT No data
Right 1043390976 8:79791321-79791343 GTGGCTTCACTTGGATACACCGG No data
1043390969_1043390976 7 Left 1043390969 8:79791291-79791313 CCCATCAGTCTTTGGACCAACCT No data
Right 1043390976 8:79791321-79791343 GTGGCTTCACTTGGATACACCGG No data
1043390967_1043390976 17 Left 1043390967 8:79791281-79791303 CCAAGTTATTCCCATCAGTCTTT No data
Right 1043390976 8:79791321-79791343 GTGGCTTCACTTGGATACACCGG No data
1043390973_1043390976 -9 Left 1043390973 8:79791307-79791329 CCAACCTTTATGGTGTGGCTTCA No data
Right 1043390976 8:79791321-79791343 GTGGCTTCACTTGGATACACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1043390976 Original CRISPR GTGGCTTCACTTGGATACAC CGG Intergenic
No off target data available for this crispr